1 | #- |
---|
2 | #- |
---|
3 | #- editor |
---|
4 | #- Mon Oct 25 12:13:24 2010 |
---|
5 | #- |
---|
6 | #- |
---|
7 | #- Reference sequence: AF375552; |
---|
8 | #- Attributes: |
---|
9 | #= AF375552; in out vis prt ord dna lin 5>3 func ref |
---|
10 | #= HSFAU in out vis prt ord dna lin 5>3 func |
---|
11 | #= HSFAU1 in out vis prt ord dna lin 5>3 func |
---|
12 | #- |
---|
13 | #:AF375552;:name:Lactococcus lactis subsp. lactis. |
---|
14 | #:AF375552;:strain:NCDO2118 tmRNA gene, partial sequence |
---|
15 | #:AF375552;:subsp:lactis |
---|
16 | #:AF375552;:atcc:NCDO 2118 tmRNA gene |
---|
17 | #:AF375552;:date:31-MAY-2001 |
---|
18 | #:AF375552;:acs:AF375552; |
---|
19 | #:AF375552;:auth:Schoenhuber,W., Le Bourhis,G., Tremblay,J., Amann,R. and |
---|
20 | #:AF375552;:auth:Kulakauskas,S. |
---|
21 | #:AF375552;:jour:BMC Microbiol. 1(1), 20-20 (2001) |
---|
22 | #:AF375552;:title:Utilization of tmRNA sequences for bacterial identification |
---|
23 | #:AF375552;:rem:ref:1 (bases 1 to 310) |
---|
24 | #:AF375552;:rem:ref:2 (bases 1 to 310) |
---|
25 | #:AF375552;:rem:auth:Schoenhuber,W., Le Bourhis,G., Tremblay,J., Amann,R.I. |
---|
26 | #:AF375552;:rem:: and Kulakauskas,S. |
---|
27 | #:AF375552;:rem:jour:Submitted (02-MAY-2001) to the EMBL/GenBank/DDBJ |
---|
28 | #:AF375552;:rem:: databases. Microbiology, Institut National de la Recherche |
---|
29 | #:AF375552;:rem:: Agronomique, Domaine de Vilvert, Jouy-en-Josas 78352, |
---|
30 | #:AF375552;:rem:: France |
---|
31 | #:AF375552;:rem:standard:No information |
---|
32 | #:AF375552;:rem:KEYWORDS:No information. |
---|
33 | #:AF375552;:rem:GenBank ACCESSION:AF375552 |
---|
34 | #:AF375552;:rem:Please note: all these entries have been modified for test |
---|
35 | #:AF375552;:rem:purposes. |
---|
36 | #:AF375552;:rem:*source: strain=NCDO2118 tmRNA gene, partial sequence; |
---|
37 | #:AF375552;:rem:*source: subspecies=lactis; |
---|
38 | #:HSFAU:name:H.sapiens fau |
---|
39 | #:HSFAU:date:25-OCT-2010 |
---|
40 | #:HSFAU:acs:X65923 |
---|
41 | #:HSFAU:rem:GenBank ACCESSION:X65923 |
---|
42 | #:HSFAU1:name:H.sapiens fau |
---|
43 | #:HSFAU1:rna:This is the content of the special entry 'Sequencing methods' |
---|
44 | #:HSFAU1:date:25-OCT-2010 |
---|
45 | #:HSFAU1:acs:X65921; |
---|
46 | #:HSFAU1:rem:GenBank ACCESSION:X65921 |
---|
47 | #:HSFAU1:rem:Source of strain:This is the content of the special entry 'Source |
---|
48 | #:HSFAU1:rem:: of strain' |
---|
49 | #:HSFAU1:rem:Former name:This is the content of the special entry 'Former |
---|
50 | #:HSFAU1:rem:: name' |
---|
51 | #:HSFAU1:rem:Alternate name:This is the content of the special entry |
---|
52 | #:HSFAU1:rem:: 'Alternate name'. It is quite long, since i need to test some |
---|
53 | #:HSFAU1:rem:: special entry which occupies many lines and when i say many |
---|
54 | #:HSFAU1:rem:: lines, i really mean at least five lines, so i could not stop |
---|
55 | #:HSFAU1:rem:: writing before i came here. |
---|
56 | #:HSFAU1:rem:Common name:This is the content of the special entry 'Common |
---|
57 | #:HSFAU1:rem:: name' |
---|
58 | #:HSFAU1:rem:Host organism:This is the content of the special entry 'Host |
---|
59 | #:HSFAU1:rem:: organism' |
---|
60 | #:HSFAU1:rem:RDP ID:This is the content of the special entry 'RDP ID' |
---|
61 | #:HSFAU1:rem:Sequencing methods:This is the content of the special entry |
---|
62 | #:HSFAU1:rem:: 'Sequencing methods' |
---|
63 | #:HSFAU1:rem:3' end complete: No |
---|
64 | #:HSFAU1:rem:5' end complete: Yes |
---|
65 | #:HSFAU1:rem:Organism and Sequence information have only been added for |
---|
66 | #:HSFAU1:rem:test purposes. They are complete nonsense! |
---|
67 | AF375552; 0 cattgtcgcgcatgaactgcaactgctgagggatcaggataatcatccgc |
---|
68 | AF375552; 50 agataaatataactgctaaaaataatacacaaacttacgcaatggcagcc |
---|
69 | AF375552; 100 taaacagcaccatgcgtgcctgatttttgctcactgatggcaatttgacg |
---|
70 | AF375552; 150 gcctaaacttttagtcagatacgttgttgtggaggcttgacgcagcaaaa |
---|
71 | AF375552; 200 gagatttaaagccccgcaaaatgtcgctgtttgagactggctttggcatt |
---|
72 | AF375552; 250 ttgttaaatttgagaaagtcctatggttgtagacgttgatgtagcaaggt |
---|
73 | AF375552; 300 gtttggacag |
---|
74 | HSFAU 0 ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtc |
---|
75 | HSFAU 50 gccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggt |
---|
76 | HSFAU 100 gaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactgg |
---|
77 | HSFAU 150 agggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctg |
---|
78 | HSFAU 200 gaggatgaggccactctgggccagtgcggggtggaggccctgactaccct |
---|
79 | HSFAU 250 ggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc |
---|
80 | HSFAU 300 gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaag |
---|
81 | HSFAU 350 aagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcg |
---|
82 | HSFAU 400 ctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgcca |
---|
83 | HSFAU 450 actcttaagtcttttgtaattctggctttctctaataaaaaagccactta |
---|
84 | HSFAU 500 gttcagtcaaaaaaaaaa |
---|
85 | HSFAU1 0 ctaccattttccctctcgattctatatgtacactcgggacaagttctcct |
---|
86 | HSFAU1 50 gatcgaaaacggcaaaactaaggccccaagtaggaatgccttagttttcg |
---|
87 | HSFAU1 100 gggttaacaatgattaacactgagcctcacacccacgcgatgccctcagc |
---|
88 | HSFAU1 150 tcctcgctcagcgctctcaccaacagccgtagcccgcagccccgctggac |
---|
89 | HSFAU1 200 accggttctccatccccgcagcgtagcccggaacatggtagctgccatct |
---|
90 | HSFAU1 250 ttacctgctacgccagccttctgtgcgcgcaactgtctggtcccgccccg |
---|
91 | HSFAU1 300 tcctgcgcgagctgctgcccaggcaggttcgccggtgcgagcgtaaaggg |
---|
92 | HSFAU1 350 gcggagctaggactgccttgggcggtacaaatagcagggaaccgcgcggt |
---|
93 | HSFAU1 400 cgctcagcagtgacgtgacacgcagcccacggtctgtactgacgcgccct |
---|
94 | HSFAU1 450 cgcttcttcctctttctcgactccatcttcgcggtagctgggaccgccgt |
---|
95 | HSFAU1 500 tcaggtaagaatggggccttggctggatccgaagggcttgtagcaggttg |
---|
96 | HSFAU1 550 gctgcggggtcagaaggcgcggggggaaccgaagaacggggcctgctccg |
---|
97 | HSFAU1 600 tggccctgctccagtccctatccgaactccttgggaggcactggccttcc |
---|
98 | HSFAU1 650 gcacgtgagccgccgcgaccaccatcccgtcgcgatcgtttctggaccgc |
---|
99 | HSFAU1 700 tttccactcccaaatctcctttatcccagagcatttcttggcttctctta |
---|
100 | HSFAU1 750 caagccgtcttttctttactcagtcgccaatatgcagctctttgtccgcg |
---|
101 | HSFAU1 800 cccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag |
---|
102 | HSFAU1 850 atcaaggtaaggctgcttggtgcgccctgggttccattttcttgtgctct |
---|
103 | HSFAU1 900 tcactctcgcggcccgagggaacgcttacgagccttatctttccctgtag |
---|
104 | HSFAU1 950 gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgct |
---|
105 | HSFAU1 1000 cctggcaggcgcgcccctggaggatgaggccactctgggccagtgcgggg |
---|
106 | HSFAU1 1050 tggaggccctgactaccctggaagtagcaggccgcatgcttggaggtgag |
---|
107 | HSFAU1 1100 tgagagaggaatgttctttgaagtaccggtaagcgtctagtgagtgtggg |
---|
108 | HSFAU1 1150 gtgcatagtcctgacagctgagtgtcacacctatggtaatagagtacttc |
---|
109 | HSFAU1 1200 tcactgtcttcagttcagagtgattcttcctgtttacatccctcatgttg |
---|
110 | HSFAU1 1250 aacacagacgtccatgggagactgagccagagtgtagttgtatttcagtc |
---|
111 | HSFAU1 1300 acatcacgagatcctagtctggttatcagcttccacactaaaaattaggt |
---|
112 | HSFAU1 1350 cagaccaggccccaaagtgctctataaattagaagctggaagatcctgaa |
---|
113 | HSFAU1 1400 atgaaacttaagatttcaaggtcaaatatctgcaactttgttctcattac |
---|
114 | HSFAU1 1450 ctattgggcgcagcttctctttaaaggcttgaattgagaaaagaggggtt |
---|
115 | HSFAU1 1500 ctgctgggtggcaccttcttgctcttacctgctggtgccttcctttccca |
---|
116 | HSFAU1 1550 ctacaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggt |
---|
117 | HSFAU1 1600 cagactcctaaggtgagtgagagtattagtggtcatggtgttaggacttt |
---|
118 | HSFAU1 1650 ttttcctttcacagctaaaccaagtccctgggctcttactcggtttgcct |
---|
119 | HSFAU1 1700 tctccctccctggagatgagcctgagggaagggatgctaggtgtggaaga |
---|
120 | HSFAU1 1750 caggaaccagggcctgattaaccttcccttctccaggtggccaaacagga |
---|
121 | HSFAU1 1800 gaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaacc |
---|
122 | HSFAU1 1850 ggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaat |
---|
123 | HSFAU1 1900 gccaactcttaagtcttttgtaattctggctttctctaataaaaaagcca |
---|
124 | HSFAU1 1950 cttagttcagtcatcgcattgtttcatctttacttgcaaggcctcaggga |
---|
125 | HSFAU1 2000 gaggtgtgcttctcgg |
---|