1 | // =============================================================== // |
---|
2 | // // |
---|
3 | // File : arb_probe.cxx // |
---|
4 | // Purpose : // |
---|
5 | // // |
---|
6 | // Institute of Microbiology (Technical University Munich) // |
---|
7 | // http://www.arb-home.de/ // |
---|
8 | // // |
---|
9 | // =============================================================== // |
---|
10 | |
---|
11 | #include <PT_com.h> |
---|
12 | #include <arbdb.h> |
---|
13 | |
---|
14 | #include <client.h> |
---|
15 | #include <servercntrl.h> |
---|
16 | |
---|
17 | #include <arb_defs.h> |
---|
18 | #include <arb_strbuf.h> |
---|
19 | #include <arb_diff.h> |
---|
20 | #include <RegExpr.hxx> |
---|
21 | |
---|
22 | #include <algorithm> |
---|
23 | #include <string> // need to include before test_unit.h |
---|
24 | #include <unistd.h> |
---|
25 | |
---|
26 | struct apd_sequence { |
---|
27 | apd_sequence *next; |
---|
28 | const char *sequence; |
---|
29 | }; |
---|
30 | |
---|
31 | struct Params { |
---|
32 | int DESIGNCLIPOUTPUT; |
---|
33 | int SERVERID; |
---|
34 | const char *DESIGNNAMES; |
---|
35 | int DESIGNPROBELEN; |
---|
36 | int DESIGNMAXPROBELEN; |
---|
37 | const char *DESIGNSEQUENCE; |
---|
38 | |
---|
39 | int MINTEMP; |
---|
40 | int MAXTEMP; |
---|
41 | int MINGC; |
---|
42 | int MAXGC; |
---|
43 | int MAXBOND; |
---|
44 | int MINPOS; |
---|
45 | int MAXPOS; |
---|
46 | int MISHIT; |
---|
47 | int MINTARGETS; |
---|
48 | const char *SEQUENCE; |
---|
49 | int MISMATCHES; |
---|
50 | int ACCEPTN; |
---|
51 | int LIMITN; |
---|
52 | int MAXRESULT; |
---|
53 | int COMPLEMENT; |
---|
54 | int WEIGHTED; |
---|
55 | |
---|
56 | apd_sequence *sequence; |
---|
57 | |
---|
58 | int ITERATE; |
---|
59 | int ITERATE_AMOUNT; |
---|
60 | int ITERATE_READABLE; |
---|
61 | const char *ITERATE_SEPARATOR; |
---|
62 | const char *ITERATE_TU; |
---|
63 | |
---|
64 | const char *DUMP; |
---|
65 | }; |
---|
66 | |
---|
67 | |
---|
68 | struct gl_struct { |
---|
69 | aisc_com *link; |
---|
70 | T_PT_MAIN com; |
---|
71 | T_PT_LOCS locs; |
---|
72 | int pd_design_id; |
---|
73 | |
---|
74 | gl_struct() |
---|
75 | : link(0), |
---|
76 | pd_design_id(0) |
---|
77 | { |
---|
78 | } |
---|
79 | |
---|
80 | }; |
---|
81 | |
---|
82 | static Params P; |
---|
83 | static gl_struct pd_gl; |
---|
84 | |
---|
85 | static int init_local_com_struct() { |
---|
86 | const char *user = GB_getenvUSER(); |
---|
87 | |
---|
88 | if (aisc_create(pd_gl.link, PT_MAIN, pd_gl.com, |
---|
89 | MAIN_LOCS, PT_LOCS, pd_gl.locs, |
---|
90 | LOCS_USER, user, |
---|
91 | NULL)) { |
---|
92 | return 1; |
---|
93 | } |
---|
94 | |
---|
95 | return 0; |
---|
96 | } |
---|
97 | |
---|
98 | static const char *AP_probe_pt_look_for_server(ARB_ERROR& error) { |
---|
99 | // DRY vs ../MULTI_PROBE/MP_noclass.cxx@MP_probe_pt_look_for_server |
---|
100 | // DRY vs ../PROBE_DESIGN/probe_design.cxx@PD_probe_pt_look_for_server |
---|
101 | const char *server_tag = GBS_ptserver_tag(P.SERVERID); |
---|
102 | error = arb_look_and_start_server(AISC_MAGIC_NUMBER, server_tag); |
---|
103 | |
---|
104 | const char *result = NULL; |
---|
105 | if (!error) { |
---|
106 | result = GBS_read_arb_tcp(server_tag); |
---|
107 | if (!result) error = GB_await_error(); |
---|
108 | } |
---|
109 | return result; |
---|
110 | } |
---|
111 | |
---|
112 | class PTserverConnection { |
---|
113 | static int count; |
---|
114 | bool need_close; |
---|
115 | public: |
---|
116 | PTserverConnection(ARB_ERROR& error) |
---|
117 | : need_close(false) |
---|
118 | { |
---|
119 | if (count) { |
---|
120 | error = "Only 1 PTserverConnection allowed"; |
---|
121 | } |
---|
122 | else { |
---|
123 | ++count; |
---|
124 | const char *servername = AP_probe_pt_look_for_server(error); |
---|
125 | if (servername) { |
---|
126 | GB_ERROR openerr = NULL; |
---|
127 | pd_gl.link = aisc_open(servername, pd_gl.com, AISC_MAGIC_NUMBER, &openerr); |
---|
128 | if (openerr) { |
---|
129 | error = openerr; |
---|
130 | } |
---|
131 | else { |
---|
132 | if (!pd_gl.link) { |
---|
133 | error = "Cannot contact PT_SERVER [1]"; |
---|
134 | } |
---|
135 | else if (init_local_com_struct()) { |
---|
136 | error = "Cannot contact PT_SERVER [2]"; |
---|
137 | } |
---|
138 | else { |
---|
139 | need_close = true; |
---|
140 | } |
---|
141 | } |
---|
142 | } |
---|
143 | } |
---|
144 | } |
---|
145 | ~PTserverConnection() { |
---|
146 | if (need_close) { |
---|
147 | aisc_close(pd_gl.link, pd_gl.com); |
---|
148 | pd_gl.link = 0; |
---|
149 | } |
---|
150 | --count; |
---|
151 | } |
---|
152 | }; |
---|
153 | int PTserverConnection::count = 0; |
---|
154 | |
---|
155 | static char *AP_dump_index_event(ARB_ERROR& error) { |
---|
156 | PTserverConnection contact(error); |
---|
157 | |
---|
158 | char *result = NULL; |
---|
159 | if (!error) { |
---|
160 | aisc_put(pd_gl.link, PT_MAIN, pd_gl.com, |
---|
161 | MAIN_DUMP_NAME, P.DUMP, |
---|
162 | NULL); |
---|
163 | |
---|
164 | if (aisc_get(pd_gl.link, PT_MAIN, pd_gl.com, |
---|
165 | MAIN_DUMP_INDEX, &result, |
---|
166 | NULL)) { |
---|
167 | error = "Connection to PT_SERVER lost (1)"; |
---|
168 | } |
---|
169 | else { |
---|
170 | result = strdup("ok"); |
---|
171 | } |
---|
172 | } |
---|
173 | return result; |
---|
174 | } |
---|
175 | |
---|
176 | static char *AP_probe_iterate_event(ARB_ERROR& error) { |
---|
177 | PTserverConnection contact(error); |
---|
178 | |
---|
179 | char *result = NULL; |
---|
180 | if (!error) { |
---|
181 | T_PT_PEP pep; |
---|
182 | int length = P.ITERATE; |
---|
183 | |
---|
184 | if (aisc_create(pd_gl.link, PT_LOCS, pd_gl.locs, |
---|
185 | LOCS_PROBE_FIND_CONFIG, PT_PEP, pep, |
---|
186 | PEP_PLENGTH, (long)length, |
---|
187 | PEP_RESTART, (long)1, |
---|
188 | PEP_READABLE, (long)P.ITERATE_READABLE, |
---|
189 | PEP_TU, (long)P.ITERATE_TU[0], |
---|
190 | PEP_SEPARATOR, (long)P.ITERATE_SEPARATOR[0], |
---|
191 | NULL)) |
---|
192 | { |
---|
193 | error = "Connection to PT_SERVER lost (1)"; |
---|
194 | } |
---|
195 | |
---|
196 | if (!error) { |
---|
197 | int amount = P.ITERATE_AMOUNT; |
---|
198 | int amount_per_call = AISC_MAX_STRING_LEN/(length+2); |
---|
199 | |
---|
200 | GBS_strstruct out(50000); |
---|
201 | bool first = true; |
---|
202 | |
---|
203 | while (amount && !error) { |
---|
204 | int this_amount = std::min(amount, amount_per_call); |
---|
205 | |
---|
206 | aisc_put(pd_gl.link, PT_PEP, pep, |
---|
207 | PEP_NUMGET, (long)this_amount, |
---|
208 | PEP_FIND_PROBES, 0, |
---|
209 | NULL); |
---|
210 | |
---|
211 | char *pep_result = 0; |
---|
212 | if (aisc_get(pd_gl.link, PT_PEP, pep, |
---|
213 | PEP_RESULT, &pep_result, |
---|
214 | NULL)) { |
---|
215 | error = "Connection to PT_SERVER lost (2)"; |
---|
216 | } |
---|
217 | |
---|
218 | if (!error) { |
---|
219 | if (pep_result[0]) { |
---|
220 | if (first) first = false; |
---|
221 | else out.put(P.ITERATE_SEPARATOR[0]); |
---|
222 | |
---|
223 | out.cat(pep_result); |
---|
224 | amount -= this_amount; |
---|
225 | } |
---|
226 | else { |
---|
227 | amount = 0; // terminate loop |
---|
228 | } |
---|
229 | } |
---|
230 | free(pep_result); |
---|
231 | } |
---|
232 | |
---|
233 | if (!error) { |
---|
234 | result = out.release(); |
---|
235 | } |
---|
236 | } |
---|
237 | } |
---|
238 | |
---|
239 | if (error) freenull(result); |
---|
240 | return result; |
---|
241 | } |
---|
242 | |
---|
243 | static char *AP_probe_design_event(ARB_ERROR& error) { |
---|
244 | PTserverConnection contact(error); |
---|
245 | |
---|
246 | if (!error) { |
---|
247 | bytestring bs; |
---|
248 | bs.data = (char*)(P.DESIGNNAMES); |
---|
249 | bs.size = strlen(bs.data)+1; |
---|
250 | |
---|
251 | T_PT_PDC pdc; |
---|
252 | if (aisc_create(pd_gl.link, PT_LOCS, pd_gl.locs, |
---|
253 | LOCS_PROBE_DESIGN_CONFIG, PT_PDC, pdc, |
---|
254 | PDC_MIN_PROBELEN, (long)P.DESIGNPROBELEN, |
---|
255 | PDC_MAX_PROBELEN, (long)P.DESIGNMAXPROBELEN, |
---|
256 | PDC_MINTEMP, (double)P.MINTEMP, |
---|
257 | PDC_MAXTEMP, (double)P.MAXTEMP, |
---|
258 | PDC_MINGC, P.MINGC/100.0, |
---|
259 | PDC_MAXGC, P.MAXGC/100.0, |
---|
260 | PDC_MAXBOND, (double)P.MAXBOND, |
---|
261 | PDC_MIN_ECOLIPOS, (long)P.MINPOS, |
---|
262 | PDC_MAX_ECOLIPOS, (long)P.MAXPOS, |
---|
263 | PDC_MISHIT, (long)P.MISHIT, |
---|
264 | PDC_MINTARGETS, P.MINTARGETS/100.0, |
---|
265 | PDC_CLIPRESULT, (long)P.DESIGNCLIPOUTPUT, |
---|
266 | NULL)) |
---|
267 | { |
---|
268 | error = "Connection to PT_SERVER lost (1)"; |
---|
269 | } |
---|
270 | |
---|
271 | if (!error) { |
---|
272 | for (apd_sequence *s = P.sequence; s; ) { |
---|
273 | apd_sequence *next = s->next; |
---|
274 | |
---|
275 | bytestring bs_seq; |
---|
276 | T_PT_SEQUENCE pts; |
---|
277 | |
---|
278 | bs_seq.data = (char*)s->sequence; |
---|
279 | bs_seq.size = strlen(bs_seq.data)+1; |
---|
280 | aisc_create(pd_gl.link, PT_PDC, pdc, |
---|
281 | PDC_SEQUENCE, PT_SEQUENCE, pts, |
---|
282 | SEQUENCE_SEQUENCE, &bs_seq, |
---|
283 | NULL); |
---|
284 | |
---|
285 | delete s; |
---|
286 | s = next; |
---|
287 | } |
---|
288 | |
---|
289 | aisc_put(pd_gl.link, PT_PDC, pdc, |
---|
290 | PDC_NAMES, &bs, |
---|
291 | PDC_GO, 0, |
---|
292 | NULL); |
---|
293 | |
---|
294 | { |
---|
295 | char *locs_error = 0; |
---|
296 | if (aisc_get(pd_gl.link, PT_LOCS, pd_gl.locs, |
---|
297 | LOCS_ERROR, &locs_error, |
---|
298 | NULL)) { |
---|
299 | error = "Connection to PT_SERVER lost (2)"; |
---|
300 | } |
---|
301 | else { |
---|
302 | if (*locs_error) error = GBS_static_string(locs_error); |
---|
303 | free(locs_error); |
---|
304 | } |
---|
305 | } |
---|
306 | |
---|
307 | if (!error) { |
---|
308 | T_PT_TPROBE tprobe; |
---|
309 | aisc_get(pd_gl.link, PT_PDC, pdc, |
---|
310 | PDC_TPROBE, tprobe.as_result_param(), |
---|
311 | NULL); |
---|
312 | |
---|
313 | |
---|
314 | GBS_strstruct *outstr = GBS_stropen(1000); |
---|
315 | |
---|
316 | if (tprobe.exists()) { |
---|
317 | char *match_info = 0; |
---|
318 | aisc_get(pd_gl.link, PT_PDC, pdc, |
---|
319 | PDC_INFO_HEADER, &match_info, |
---|
320 | NULL); |
---|
321 | GBS_strcat(outstr, match_info); |
---|
322 | GBS_chrcat(outstr, '\n'); |
---|
323 | free(match_info); |
---|
324 | } |
---|
325 | |
---|
326 | |
---|
327 | while (tprobe.exists()) { |
---|
328 | char *match_info = 0; |
---|
329 | if (aisc_get(pd_gl.link, PT_TPROBE, tprobe, |
---|
330 | TPROBE_NEXT, tprobe.as_result_param(), |
---|
331 | TPROBE_INFO, &match_info, |
---|
332 | NULL)) break; |
---|
333 | GBS_strcat(outstr, match_info); |
---|
334 | GBS_chrcat(outstr, '\n'); |
---|
335 | free(match_info); |
---|
336 | } |
---|
337 | |
---|
338 | return GBS_strclose(outstr); |
---|
339 | } |
---|
340 | } |
---|
341 | } |
---|
342 | return NULL; |
---|
343 | } |
---|
344 | |
---|
345 | static char *AP_probe_match_event(ARB_ERROR& error) { |
---|
346 | PTserverConnection contact(error); |
---|
347 | |
---|
348 | if (!error && |
---|
349 | aisc_nput(pd_gl.link, PT_LOCS, pd_gl.locs, |
---|
350 | LOCS_MATCH_REVERSED, (long)P.COMPLEMENT, |
---|
351 | LOCS_MATCH_SORT_BY, (long)P.WEIGHTED, |
---|
352 | LOCS_MATCH_COMPLEMENT, 0L, |
---|
353 | LOCS_MATCH_MAX_MISMATCHES, (long)P.MISMATCHES, |
---|
354 | LOCS_MATCH_N_ACCEPT, (long)P.ACCEPTN, |
---|
355 | LOCS_MATCH_N_LIMIT, (long)P.LIMITN, |
---|
356 | LOCS_MATCH_MAX_HITS, (long)P.MAXRESULT, |
---|
357 | LOCS_SEARCHMATCH, P.SEQUENCE, |
---|
358 | NULL)) { |
---|
359 | error = "Connection to PT_SERVER lost (1)"; |
---|
360 | } |
---|
361 | |
---|
362 | if (!error) { |
---|
363 | bytestring bs; |
---|
364 | bs.data = 0; |
---|
365 | { |
---|
366 | char *locs_error = 0; |
---|
367 | T_PT_MATCHLIST match_list; |
---|
368 | long match_list_cnt; |
---|
369 | |
---|
370 | aisc_get(pd_gl.link, PT_LOCS, pd_gl.locs, |
---|
371 | LOCS_MATCH_LIST, match_list.as_result_param(), |
---|
372 | LOCS_MATCH_LIST_CNT, &match_list_cnt, |
---|
373 | LOCS_MATCH_STRING, &bs, |
---|
374 | LOCS_ERROR, &locs_error, |
---|
375 | NULL); |
---|
376 | if (*locs_error) error = GBS_static_string(locs_error); |
---|
377 | free(locs_error); |
---|
378 | } |
---|
379 | |
---|
380 | if (!error) return bs.data; // freed by caller |
---|
381 | free(bs.data); |
---|
382 | } |
---|
383 | return NULL; |
---|
384 | } |
---|
385 | |
---|
386 | static int pargc; |
---|
387 | static const char **pargv = NULL; |
---|
388 | static bool showhelp; |
---|
389 | |
---|
390 | static int getInt(const char *param, int val, int min, int max, const char *description) { |
---|
391 | if (showhelp) { |
---|
392 | printf(" %s=%i [%i .. %i] %s\n", param, val, min, max, description); |
---|
393 | return 0; |
---|
394 | } |
---|
395 | int i; |
---|
396 | const char *s = 0; |
---|
397 | |
---|
398 | arb_assert(pargc >= 1); // otherwise s stays 0 |
---|
399 | |
---|
400 | for (i=1; i<pargc; i++) { |
---|
401 | s = pargv[i]; |
---|
402 | if (*s == '-') s++; |
---|
403 | if (!strncasecmp(s, param, strlen(param))) break; |
---|
404 | } |
---|
405 | if (i==pargc) return val; |
---|
406 | s += strlen(param); |
---|
407 | if (*s != '=') return val; |
---|
408 | s++; |
---|
409 | val = atoi(s); |
---|
410 | pargc--; // remove parameter |
---|
411 | for (; i<pargc; i++) { |
---|
412 | pargv[i] = pargv[i+1]; |
---|
413 | } |
---|
414 | |
---|
415 | if (val<min) val = min; |
---|
416 | if (val>max) val = max; |
---|
417 | return val; |
---|
418 | } |
---|
419 | |
---|
420 | static const char *getString(const char *param, const char *val, const char *description) { |
---|
421 | if (showhelp) { |
---|
422 | if (!val) val = ""; |
---|
423 | printf(" %s=%s %s\n", param, val, description); |
---|
424 | return 0; |
---|
425 | } |
---|
426 | int i; |
---|
427 | const char *s = 0; |
---|
428 | |
---|
429 | arb_assert(pargc >= 1); // otherwise s stays 0 |
---|
430 | |
---|
431 | for (i=1; i<pargc; i++) { |
---|
432 | s = pargv[i]; |
---|
433 | if (*s == '-') s++; |
---|
434 | if (!strncasecmp(s, param, strlen(param))) break; |
---|
435 | } |
---|
436 | if (i==pargc) return val; |
---|
437 | s += strlen(param); |
---|
438 | if (*s != '=') return val; |
---|
439 | s++; |
---|
440 | pargc--; // remove parameter |
---|
441 | for (; i<pargc; i++) { |
---|
442 | pargv[i] = pargv[i+1]; |
---|
443 | } |
---|
444 | return s; |
---|
445 | } |
---|
446 | |
---|
447 | static bool parseCommandLine(int argc, const char * const * const argv) { |
---|
448 | pargc = argc; |
---|
449 | |
---|
450 | // copy argv (since parser will remove matched arguments) |
---|
451 | free(pargv); |
---|
452 | pargv = (const char **)malloc(sizeof(*pargv)*pargc); |
---|
453 | for (int i=0; i<pargc; i++) pargv[i] = argv[i]; |
---|
454 | |
---|
455 | showhelp = (pargc <= 1); |
---|
456 | |
---|
457 | #ifdef UNIT_TESTS // UT_DIFF |
---|
458 | const int minServerID = TEST_GENESERVER_ID; |
---|
459 | #else // !UNIT_TESTS |
---|
460 | const int minServerID = 0; |
---|
461 | #endif |
---|
462 | |
---|
463 | P.SERVERID = getInt("serverid", 0, minServerID, 100, "Server Id, look into $ARBHOME/lib/arb_tcp.dat"); |
---|
464 | #ifdef UNIT_TESTS // UT_DIFF |
---|
465 | if (P.SERVERID<0) { arb_assert(P.SERVERID == TEST_SERVER_ID || P.SERVERID == TEST_GENESERVER_ID); } |
---|
466 | #endif |
---|
467 | |
---|
468 | P.DESIGNCLIPOUTPUT = getInt("designmaxhits", 100, 10, 10000, "Maximum Number of Probe Design Suggestions"); |
---|
469 | P.DESIGNNAMES = getString("designnames", "", "List of short names separated by '#'"); |
---|
470 | |
---|
471 | P.sequence = 0; |
---|
472 | while ((P.DESIGNSEQUENCE = getString("designsequence", 0, "Additional Sequences, will be added to the target group"))) { |
---|
473 | apd_sequence *s = new apd_sequence; |
---|
474 | s->next = P.sequence; |
---|
475 | P.sequence = s; |
---|
476 | s->sequence = P.DESIGNSEQUENCE; |
---|
477 | P.DESIGNSEQUENCE = 0; |
---|
478 | } |
---|
479 | P.DESIGNPROBELEN = getInt("designprobelength", 18, 2, 100, "(min.) length of probe"); |
---|
480 | P.DESIGNMAXPROBELEN = getInt("designmaxprobelength", -1, -1, 100, "max. length of probe (if specified)"); |
---|
481 | P.MINTEMP = getInt("designmintemp", 0, 0, 400, "Minimum melting temperature of probe"); |
---|
482 | P.MAXTEMP = getInt("designmaxtemp", 400, 0, 400, "Maximum melting temperature of probe"); |
---|
483 | P.MINGC = getInt("designmingc", 30, 0, 100, "Minimum gc content"); |
---|
484 | P.MAXGC = getInt("designmaxgc", 80, 0, 100, "Maximum gc content"); |
---|
485 | P.MAXBOND = getInt("designmaxbond", 0, 0, 10, "Not implemented"); |
---|
486 | P.MINPOS = getInt("designminpos", -1, -1, INT_MAX, "Minimum ecoli position (-1=none)"); |
---|
487 | P.MAXPOS = getInt("designmaxpos", -1, -1, INT_MAX, "Maximum ecoli position (-1=none)"); |
---|
488 | P.MISHIT = getInt("designmishit", 0, 0, 10000, "Number of allowed hits outside the selected group"); |
---|
489 | P.MINTARGETS = getInt("designmintargets", 50, 0, 100, "Minimum percentage of hits within the selected species"); |
---|
490 | |
---|
491 | P.SEQUENCE = getString("matchsequence", "agtagtagt", "The sequence to search for"); |
---|
492 | |
---|
493 | P.MISMATCHES = getInt("matchmismatches", 0, 0, 5, "Maximum Number of allowed mismatches"); |
---|
494 | P.COMPLEMENT = getInt("matchcomplement", 0, 0, 1, "Match reversed and complemented probe"); |
---|
495 | P.WEIGHTED = getInt("matchweighted", 0, 0, 1, "Use weighted mismatches"); |
---|
496 | P.ACCEPTN = getInt("matchacceptN", 1, 0, 20, "Amount of N-matches not counted as mismatch"); |
---|
497 | P.LIMITN = getInt("matchlimitN", 4, 0, 20, "Limit for N-matches. If reached N-matches are mismatches"); |
---|
498 | P.MAXRESULT = getInt("matchmaxresults", 1000000, 0, INT_MAX, "Max. number of matches reported (0=unlimited)"); |
---|
499 | |
---|
500 | P.ITERATE = getInt("iterate", 0, 1, 20, "Iterate over probes of given length"); |
---|
501 | P.ITERATE_AMOUNT = getInt("iterate_amount", 100, 1, INT_MAX, "Number of results per answer"); |
---|
502 | P.ITERATE_READABLE = getInt("iterate_readable", 1, 0, 1, "readable results"); |
---|
503 | |
---|
504 | P.ITERATE_TU = getString("iterate_tu", "T", "use T or U in readable result"); |
---|
505 | P.ITERATE_SEPARATOR = getString("iterate_separator", ";", "Number of results per answer"); |
---|
506 | |
---|
507 | P.DUMP = getString("dump", "", "dump ptserver index to file (may be huge!)"); |
---|
508 | |
---|
509 | if (pargc>1) { |
---|
510 | printf("Unknown (or duplicate) parameter %s\n", pargv[1]); |
---|
511 | return false; |
---|
512 | } |
---|
513 | return !showhelp; |
---|
514 | } |
---|
515 | |
---|
516 | // -------------------------------------------------------------------------------- |
---|
517 | |
---|
518 | #ifdef UNIT_TESTS |
---|
519 | #ifndef TEST_UNIT_H |
---|
520 | #include <test_unit.h> |
---|
521 | #endif |
---|
522 | |
---|
523 | void TEST_BASIC_parseCommandLine() { |
---|
524 | { |
---|
525 | const char *args[] = { NULL, "serverid=0"}; |
---|
526 | TEST_EXPECT(parseCommandLine(ARRAY_ELEMS(args), args)); |
---|
527 | |
---|
528 | // test default values here |
---|
529 | TEST_EXPECT_EQUAL(P.ACCEPTN, 1); |
---|
530 | TEST_EXPECT_EQUAL(P.LIMITN, 4); |
---|
531 | TEST_EXPECT_EQUAL(P.MISMATCHES, 0); |
---|
532 | TEST_EXPECT_EQUAL(P.MAXRESULT, 1000000); |
---|
533 | } |
---|
534 | |
---|
535 | { |
---|
536 | const char *args[] = {NULL, "serverid=4", "matchmismatches=2"}; |
---|
537 | TEST_EXPECT(parseCommandLine(ARRAY_ELEMS(args), args)); |
---|
538 | TEST_EXPECT_EQUAL(P.SERVERID, 4); |
---|
539 | TEST_EXPECT_EQUAL(P.MISMATCHES, 2); |
---|
540 | TEST_EXPECT_EQUAL(args[1], "serverid=4"); // check array args was not modified |
---|
541 | } |
---|
542 | |
---|
543 | { |
---|
544 | const char *args[] = { NULL, "matchacceptN=0", "matchlimitN=5"}; |
---|
545 | TEST_EXPECT(parseCommandLine(ARRAY_ELEMS(args), args)); |
---|
546 | TEST_EXPECT_EQUAL(P.ACCEPTN, 0); |
---|
547 | TEST_EXPECT_EQUAL(P.LIMITN, 5); |
---|
548 | } |
---|
549 | |
---|
550 | { |
---|
551 | const char *args[] = { NULL, "matchmaxresults=100"}; |
---|
552 | TEST_EXPECT(parseCommandLine(ARRAY_ELEMS(args), args)); |
---|
553 | TEST_EXPECT_EQUAL(P.MAXRESULT, 100); |
---|
554 | } |
---|
555 | } |
---|
556 | |
---|
557 | #endif // UNIT_TESTS |
---|
558 | |
---|
559 | // -------------------------------------------------------------------------------- |
---|
560 | |
---|
561 | |
---|
562 | static char *execute(ARB_ERROR& error) { |
---|
563 | char *answer; |
---|
564 | if (*P.DESIGNNAMES || P.sequence) { |
---|
565 | answer = AP_probe_design_event(error); |
---|
566 | } |
---|
567 | else if (P.ITERATE>0) { |
---|
568 | answer = AP_probe_iterate_event(error); |
---|
569 | } |
---|
570 | else if (P.DUMP[0]) { |
---|
571 | answer = AP_dump_index_event(error); |
---|
572 | } |
---|
573 | else { |
---|
574 | answer = AP_probe_match_event(error); |
---|
575 | } |
---|
576 | pd_gl.locs.clear(); |
---|
577 | return answer; |
---|
578 | } |
---|
579 | |
---|
580 | int ARB_main(int argc, char *argv[]) { |
---|
581 | bool ok = parseCommandLine(argc, argv); |
---|
582 | if (ok) { |
---|
583 | ARB_ERROR error; |
---|
584 | char *answer = execute(error); |
---|
585 | |
---|
586 | arb_assert(contradicted(answer, error)); |
---|
587 | |
---|
588 | if (!answer) { |
---|
589 | fprintf(stderr, |
---|
590 | "arb_probe: Failed to process your request\n" |
---|
591 | " Reason: %s", |
---|
592 | error.deliver()); |
---|
593 | ok = false; |
---|
594 | } |
---|
595 | else { |
---|
596 | fputs(answer, stdout); |
---|
597 | free(answer); |
---|
598 | error.expect_no_error(); |
---|
599 | } |
---|
600 | } |
---|
601 | return ok ? EXIT_SUCCESS : EXIT_FAILURE; |
---|
602 | } |
---|
603 | |
---|
604 | // -------------------------------------------------------------------------------- |
---|
605 | |
---|
606 | #ifdef UNIT_TESTS |
---|
607 | #ifndef TEST_UNIT_H |
---|
608 | #include <test_unit.h> |
---|
609 | #endif |
---|
610 | |
---|
611 | static int test_setup(bool use_gene_ptserver) { |
---|
612 | static bool setup[2] = { false, false }; |
---|
613 | if (!setup[use_gene_ptserver]) { |
---|
614 | TEST_SETUP_GLOBAL_ENVIRONMENT(use_gene_ptserver ? "ptserver_gene" : "ptserver"); // first call will recreate the test pt-server |
---|
615 | setup[use_gene_ptserver] = true; |
---|
616 | } |
---|
617 | return use_gene_ptserver ? TEST_GENESERVER_ID : TEST_SERVER_ID; |
---|
618 | } |
---|
619 | |
---|
620 | // ---------------------------------- |
---|
621 | // test probe design / match |
---|
622 | |
---|
623 | #define TEST_RUN_ARB_PROBE__INT(fake_argc,fake_argv) \ |
---|
624 | int serverid = test_setup(use_gene_ptserver); \ |
---|
625 | TEST_EXPECT_EQUAL(true, parseCommandLine(fake_argc, fake_argv)); \ |
---|
626 | TEST_EXPECT((serverid == TEST_SERVER_ID)||(serverid == TEST_GENESERVER_ID)); \ |
---|
627 | P.SERVERID = serverid; \ |
---|
628 | ARB_ERROR error; \ |
---|
629 | char *answer = execute(error) |
---|
630 | |
---|
631 | #define TEST_ARB_PROBE__REPORTS_ERROR(fake_argc,fake_argv,expected_error) \ |
---|
632 | TEST_RUN_ARB_PROBE__INT(fake_argc,fake_argv); \ |
---|
633 | free(answer); \ |
---|
634 | TEST_EXPECT_ERROR_CONTAINS(error.deliver(), expected_error) |
---|
635 | |
---|
636 | #define TEST_ARB_PROBE__REPORTS_ERROR__BROKEN(fake_argc,fake_argv,expected_error) \ |
---|
637 | TEST_RUN_ARB_PROBE__INT(fake_argc,fake_argv); \ |
---|
638 | free(answer); \ |
---|
639 | TEST_EXPECT_ANY_ERROR(error.preserve()); \ |
---|
640 | TEST_EXPECT_ERROR_CONTAINS__BROKEN(error.deliver(), expected_error) |
---|
641 | |
---|
642 | |
---|
643 | #define TEST_RUN_ARB_PROBE(fake_argc,fake_argv) \ |
---|
644 | TEST_RUN_ARB_PROBE__INT(fake_argc,fake_argv); \ |
---|
645 | TEST_EXPECT_NO_ERROR(error.deliver()) |
---|
646 | |
---|
647 | #define TEST_ARB_PROBE(fake_argc,fake_argv,expected) do { \ |
---|
648 | TEST_RUN_ARB_PROBE(fake_argc,fake_argv); \ |
---|
649 | TEST_EXPECT_EQUAL(answer, expected); \ |
---|
650 | free(answer); \ |
---|
651 | } while(0) |
---|
652 | |
---|
653 | #define TEST_ARB_PROBE__BROKEN(fake_argc,fake_argv,expected) do { \ |
---|
654 | TEST_RUN_ARB_PROBE(fake_argc,fake_argv); \ |
---|
655 | TEST_EXPECT_EQUAL__BROKEN(answer, expected); \ |
---|
656 | free(answer); \ |
---|
657 | } while(0) |
---|
658 | |
---|
659 | #define TEST_ARB_PROBE_FILT(fake_argc,fake_argv,filter,expected) do { \ |
---|
660 | TEST_RUN_ARB_PROBE(fake_argc,fake_argv); \ |
---|
661 | char *filtered = filter(answer); \ |
---|
662 | TEST_EXPECT_EQUAL(filtered, expected); \ |
---|
663 | free(filtered); \ |
---|
664 | free(answer); \ |
---|
665 | } while(0) |
---|
666 | |
---|
667 | typedef const char *CCP; |
---|
668 | |
---|
669 | void TEST_SLOW_match_geneprobe() { |
---|
670 | // test here runs versus database ../UNIT_TESTER/run/TEST_gpt_src.arb |
---|
671 | |
---|
672 | bool use_gene_ptserver = true; |
---|
673 | { |
---|
674 | const char *arguments[] = { |
---|
675 | "prgnamefake", |
---|
676 | "matchsequence=NNUCNN", |
---|
677 | "matchacceptN=4", |
---|
678 | "matchlimitN=5", |
---|
679 | }; |
---|
680 | CCP expectd = " organism genename------- mis N_mis wmis pos gpos rev 'NNUCNN'\1" |
---|
681 | "genome2\1" " genome2 gene3 0 4 2.6 2 1 0 .........-UU==GG-UUGAUC.\1" |
---|
682 | "genome2\1" " genome2 joined1 0 4 2.6 2 1 0 .........-UU==GG-UUGAUCCUG\1" |
---|
683 | "genome2\1" " genome2 gene1 0 4 2.6 2 2 0 ........A-UU==GG-U.\1" |
---|
684 | "genome2\1" " genome2 intergene_19_65 0 4 2.7 31 12 0 GGUUACUGC-AU==GG-UGUUCGCCU\1" |
---|
685 | "genome1\1" " genome1 intergene_17_65 0 4 2.7 31 14 0 GGUUACUGC-UA==GG-UGUUCGCCU\1" |
---|
686 | "genome2\1" " genome2 intergene_19_65 0 4 2.7 38 19 0 GCAUUCGGU-GU==GC-CUAAGCACU\1" |
---|
687 | "genome1\1" " genome1 intergene_17_65 0 4 2.7 38 21 0 GCUAUCGGU-GU==GC-CUAAGCCAU\1" |
---|
688 | "genome2\1" " genome2 gene3 0 4 2.9 10 9 0 .UUUCGGUU-GA==..-\1" |
---|
689 | "genome2\1" " genome2 intergene_19_65 0 4 3.1 56 37 0 AGCACUGCG-AG==AU-AUGUA.\1" |
---|
690 | "genome1\1" " genome1 intergene_17_65 0 4 3.1 56 39 0 AGCCAUGCG-AG==AU-AUGUA.\1" |
---|
691 | "genome1\1" " genome1 gene2 0 4 3.1 10 2 0 ........U-GA==CU-GC.\1" |
---|
692 | "genome2\1" " genome2 gene2 0 4 3.1 10 4 0 ......GUU-GA==CU-GCCA.\1" |
---|
693 | "genome1\1" " genome1 joined1 0 4 3.1 10 7 0 ...CUGGUU-GA==CU-GC.\1" |
---|
694 | "genome2\1" " genome2 joined1 0 4 3.1 10 9 0 .UUUCGGUU-GA==CU-GCCA.\1"; |
---|
695 | |
---|
696 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd); |
---|
697 | } |
---|
698 | |
---|
699 | { |
---|
700 | const char *arguments[] = { |
---|
701 | "prgnamefake", |
---|
702 | "matchsequence=NGGUUN", |
---|
703 | "matchacceptN=2", |
---|
704 | "matchlimitN=3", |
---|
705 | }; |
---|
706 | CCP expectd = " organism genename------- mis N_mis wmis pos gpos rev 'NGGUUN'\1" |
---|
707 | "genome1\1" " genome1 gene3 0 2 1.3 5 2 0 ........C-U====G-A.\1" |
---|
708 | "genome1\1" " genome1 joined1 0 2 1.3 5 2 0 ........C-U====G-AUCCUGC.\1" |
---|
709 | "genome2\1" " genome2 gene3 0 2 1.4 5 4 0 ......UUU-C====G-AUC.\1" |
---|
710 | "genome2\1" " genome2 joined1 0 2 1.4 5 4 0 ......UUU-C====G-AUCCUGCCA\1" |
---|
711 | "genome2\1" " genome2 intergene_19_65 0 2 1.8 21 2 0 ........G-A====A-CUGCAUUCG\1" |
---|
712 | "genome1\1" " genome1 intergene_17_65 0 2 1.8 21 4 0 ......CAG-A====A-CUGCUAUCG\1"; |
---|
713 | |
---|
714 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd); |
---|
715 | } |
---|
716 | |
---|
717 | { |
---|
718 | const char *arguments[] = { |
---|
719 | "prgnamefake", |
---|
720 | "matchsequence=UGAUCCU", // exists in data |
---|
721 | }; |
---|
722 | CCP expectd = " organism genename mis N_mis wmis pos gpos rev 'UGAUCCU'\1" |
---|
723 | "genome1\1" " genome1 gene2 0 0 0.0 9 1 0 .........-=======-GC.\1" |
---|
724 | "genome2\1" " genome2 gene2 0 0 0.0 9 3 0 .......GU-=======-GCCA.\1" |
---|
725 | "genome1\1" " genome1 joined1 0 0 0.0 9 6 0 ....CUGGU-=======-GC.\1" |
---|
726 | "genome2\1" " genome2 joined1 0 0 0.0 9 8 0 ..UUUCGGU-=======-GCCA.\1"; |
---|
727 | |
---|
728 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd); // [fixed: now reports hits in 'joined1' (of both genomes)] |
---|
729 | } |
---|
730 | { |
---|
731 | const char *arguments[] = { |
---|
732 | "prgnamefake", |
---|
733 | "matchsequence=GAUCCU", |
---|
734 | }; |
---|
735 | CCP expectd = " organism genename mis N_mis wmis pos gpos rev 'GAUCCU'\1" |
---|
736 | "genome1\1" " genome1 gene2 0 0 0.0 10 2 0 ........U-======-GC.\1" |
---|
737 | "genome2\1" " genome2 gene2 0 0 0.0 10 4 0 ......GUU-======-GCCA.\1" |
---|
738 | "genome1\1" " genome1 joined1 0 0 0.0 10 7 0 ...CUGGUU-======-GC.\1" |
---|
739 | "genome2\1" " genome2 joined1 0 0 0.0 10 9 0 .UUUCGGUU-======-GCCA.\1"; |
---|
740 | |
---|
741 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd); // [fixed: now reports as much hits as previous test; expected cause probe is part of above probe] |
---|
742 | } |
---|
743 | { |
---|
744 | const char *arguments[] = { |
---|
745 | "prgnamefake", |
---|
746 | "matchsequence=UUUCGG", // exists only in genome2 |
---|
747 | }; |
---|
748 | CCP expectd = " organism genename mis N_mis wmis pos gpos rev 'UUUCGG'\1" |
---|
749 | "genome2\1" " genome2 gene3 0 0 0.0 2 1 0 .........-======-UUGAUC.\1" |
---|
750 | "genome2\1" " genome2 joined1 0 0 0.0 2 1 0 .........-======-UUGAUCCUG\1" |
---|
751 | "genome2\1" " genome2 gene1 0 0 0.0 2 2 0 ........A-======-U.\1"; |
---|
752 | |
---|
753 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd); // [fixed: now reports hit in genome2/gene1] |
---|
754 | } |
---|
755 | { |
---|
756 | const char *arguments[] = { |
---|
757 | "prgnamefake", |
---|
758 | "matchsequence=AUCCUG", |
---|
759 | }; |
---|
760 | CCP expectd = " organism genename mis N_mis wmis pos gpos rev 'AUCCUG'\1" |
---|
761 | "genome1\1" " genome1 gene2 0 0 0.0 11 3 0 .......UG-======-C.\1" |
---|
762 | "genome2\1" " genome2 gene2 0 0 0.0 11 5 0 .....GUUG-======-CCA.\1" |
---|
763 | "genome1\1" " genome1 joined1 0 0 0.0 11 8 0 ..CUGGUUG-======-C.\1" |
---|
764 | "genome2\1" " genome2 joined1 0 0 0.0 11 10 0 UUUCGGUUG-======-CCA.\1"; |
---|
765 | |
---|
766 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd); // [fixed: now reports hits in 'gene2' and 'joined1' of both genomes] |
---|
767 | } |
---|
768 | { |
---|
769 | const char *arguments[] = { |
---|
770 | "prgnamefake", |
---|
771 | "matchsequence=UUGAUCCUGC", |
---|
772 | }; |
---|
773 | CCP expectd = " organism genename mis N_mis wmis pos gpos rev 'UUGAUCCUGC'\1" |
---|
774 | "genome2\1" " genome2 gene2 0 0 0.0 8 2 0 ........G-==========-CA.\1" |
---|
775 | "genome1\1" " genome1 joined1 0 0 0.0 8 5 0 .....CUGG-==========-.\1" |
---|
776 | "genome2\1" " genome2 joined1 0 0 0.0 8 7 0 ...UUUCGG-==========-CA.\1"; |
---|
777 | |
---|
778 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd); // [fixed: now reports hit in 'genome2/joined1'] |
---|
779 | } |
---|
780 | } |
---|
781 | |
---|
782 | void TEST_SLOW_match_probe() { |
---|
783 | // test here runs versus database ../UNIT_TESTER/run/TEST_pt_src.arb |
---|
784 | |
---|
785 | bool use_gene_ptserver = false; |
---|
786 | { |
---|
787 | const char *arguments[] = { |
---|
788 | "prgnamefake", |
---|
789 | "matchsequence=UAUCGGAGAGUUUGA", |
---|
790 | }; |
---|
791 | CCP expected = " name---- fullname mis N_mis wmis pos ecoli rev 'UAUCGGAGAGUUUGA'\1" |
---|
792 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 3 2 0 .......UU-===============-UCAAGUCGA\1"; |
---|
793 | |
---|
794 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
795 | } |
---|
796 | |
---|
797 | // ---------------------------------------------------------------------------- |
---|
798 | // match with old(=default) N-mismatch-behavior (accepting 1 N-match) |
---|
799 | |
---|
800 | { |
---|
801 | const char *arguments[] = { |
---|
802 | "prgnamefake", |
---|
803 | "matchsequence=CANCUCCUUUC", // contains 1 N |
---|
804 | NULL // matchmismatches |
---|
805 | }; |
---|
806 | |
---|
807 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUUC'\1" |
---|
808 | "BcSSSS00\1" " BcSSSS00 0 1 0.9 176 162 0 CGGCUGGAU-==C========-U.\1"; // only N-mismatch accepted |
---|
809 | |
---|
810 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUUC'\1" |
---|
811 | "BcSSSS00\1" " BcSSSS00 0 1 0.9 176 162 0 CGGCUGGAU-==C========-U.\1" |
---|
812 | "ClfPerfr\1" " ClfPerfr 1 1 2.0 176 162 0 AGAUUAAUA-=CC========-U.\1" |
---|
813 | "PbcAcet2\1" " PbcAcet2 1 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
814 | "PbrPropi\1" " PbrPropi 1 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
815 | "Stsssola\1" " Stsssola 1 2 1.6 176 162 0 CGGCUGGAU-==C=======.-\1" |
---|
816 | "DcdNodos\1" " DcdNodos 1 2 1.6 176 162 0 CGGUUGGAU-==C=======.-\1" |
---|
817 | "VbrFurni\1" " VbrFurni 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
818 | "VblVulni\1" " VblVulni 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
819 | "VbhChole\1" " VbhChole 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1"; |
---|
820 | |
---|
821 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUUC'\1" |
---|
822 | "BcSSSS00\1" " BcSSSS00 0 1 0.9 176 162 0 CGGCUGGAU-==C========-U.\1" |
---|
823 | "ClfPerfr\1" " ClfPerfr 1 1 2.0 176 162 0 AGAUUAAUA-=CC========-U.\1" |
---|
824 | "PbcAcet2\1" " PbcAcet2 1 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
825 | "PbrPropi\1" " PbrPropi 1 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
826 | "Stsssola\1" " Stsssola 1 2 1.6 176 162 0 CGGCUGGAU-==C=======.-\1" |
---|
827 | "DcdNodos\1" " DcdNodos 1 2 1.6 176 162 0 CGGUUGGAU-==C=======.-\1" |
---|
828 | "VbrFurni\1" " VbrFurni 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
829 | "VblVulni\1" " VblVulni 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
830 | "VbhChole\1" " VbhChole 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
831 | "AclPleur\1" " AclPleur 2 2 2.7 176 162 0 CGGUUGGAU-==C======A.-\1" |
---|
832 | "PtVVVulg\1" " PtVVVulg 2 2 2.7 176 162 0 CGGUUGGAU-==C======A.-\1" |
---|
833 | "DlcTolu2\1" " DlcTolu2 2 3 2.3 176 162 0 CGGCUGGAU-==C======NN-N.\1" |
---|
834 | "FrhhPhil\1" " FrhhPhil 2 3 2.3 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
835 | "HllHalod\1" " HllHalod 2 3 2.3 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
836 | "CPPParap\1" " CPPParap 2 3 2.3 177 163 0 CGGNUGGAU-==C======..-\1"; |
---|
837 | |
---|
838 | CCP expectd3 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUUC'\1" |
---|
839 | "BcSSSS00\1" " BcSSSS00 0 1 0.9 176 162 0 CGGCUGGAU-==C========-U.\1" |
---|
840 | "ClfPerfr\1" " ClfPerfr 1 1 2.0 176 162 0 AGAUUAAUA-=CC========-U.\1" |
---|
841 | "PbcAcet2\1" " PbcAcet2 1 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
842 | "PbrPropi\1" " PbrPropi 1 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
843 | "Stsssola\1" " Stsssola 1 2 1.6 176 162 0 CGGCUGGAU-==C=======.-\1" |
---|
844 | "DcdNodos\1" " DcdNodos 1 2 1.6 176 162 0 CGGUUGGAU-==C=======.-\1" |
---|
845 | "VbrFurni\1" " VbrFurni 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
846 | "VblVulni\1" " VblVulni 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
847 | "VbhChole\1" " VbhChole 1 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
848 | "AclPleur\1" " AclPleur 2 2 2.7 176 162 0 CGGUUGGAU-==C======A.-\1" |
---|
849 | "PtVVVulg\1" " PtVVVulg 2 2 2.7 176 162 0 CGGUUGGAU-==C======A.-\1" |
---|
850 | "DlcTolu2\1" " DlcTolu2 2 3 2.3 176 162 0 CGGCUGGAU-==C======NN-N.\1" |
---|
851 | "FrhhPhil\1" " FrhhPhil 2 3 2.3 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
852 | "HllHalod\1" " HllHalod 2 3 2.3 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
853 | "CPPParap\1" " CPPParap 2 3 2.3 177 163 0 CGGNUGGAU-==C======..-\1" |
---|
854 | "VblVulni\1" " VblVulni 3 1 3.6 49 44 0 AGCACAGAG-a=A==uG====-UCGGGUGGC\1"; |
---|
855 | |
---|
856 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
857 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
858 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
859 | arguments[2] = "matchmismatches=3"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd3); |
---|
860 | } |
---|
861 | |
---|
862 | { |
---|
863 | const char *arguments[] = { |
---|
864 | "prgnamefake", |
---|
865 | "matchsequence=UCACCUCCUUUC", // contains no N |
---|
866 | NULL // matchmismatches |
---|
867 | }; |
---|
868 | |
---|
869 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
870 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
871 | "PbcAcet2\1" " PbcAcet2 0 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
872 | "PbrPropi\1" " PbrPropi 0 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
873 | "Stsssola\1" " Stsssola 0 1 0.7 175 161 0 GCGGCUGGA-===========.-\1" |
---|
874 | "DcdNodos\1" " DcdNodos 0 1 0.7 175 161 0 GCGGUUGGA-===========.-\1" |
---|
875 | "VbrFurni\1" " VbrFurni 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
876 | "VblVulni\1" " VblVulni 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
877 | "VbhChole\1" " VbhChole 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1"; |
---|
878 | |
---|
879 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
880 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
881 | "PbcAcet2\1" " PbcAcet2 0 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
882 | "PbrPropi\1" " PbrPropi 0 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
883 | "Stsssola\1" " Stsssola 0 1 0.7 175 161 0 GCGGCUGGA-===========.-\1" |
---|
884 | "DcdNodos\1" " DcdNodos 0 1 0.7 175 161 0 GCGGUUGGA-===========.-\1" |
---|
885 | "VbrFurni\1" " VbrFurni 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
886 | "VblVulni\1" " VblVulni 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
887 | "VbhChole\1" " VbhChole 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
888 | "AclPleur\1" " AclPleur 1 1 1.8 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
889 | "PtVVVulg\1" " PtVVVulg 1 1 1.8 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
890 | "DlcTolu2\1" " DlcTolu2 1 2 1.4 175 161 0 GCGGCUGGA-==========NN-N.\1" |
---|
891 | "FrhhPhil\1" " FrhhPhil 1 2 1.4 175 161 0 GCGGCUGGA-==========..-\1" |
---|
892 | "HllHalod\1" " HllHalod 1 2 1.4 175 161 0 GCGGCUGGA-==========..-\1" |
---|
893 | "CPPParap\1" " CPPParap 1 2 1.4 176 162 0 GCGGNUGGA-==========..-\1"; |
---|
894 | |
---|
895 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
896 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
897 | "PbcAcet2\1" " PbcAcet2 0 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
898 | "PbrPropi\1" " PbrPropi 0 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
899 | "Stsssola\1" " Stsssola 0 1 0.7 175 161 0 GCGGCUGGA-===========.-\1" |
---|
900 | "DcdNodos\1" " DcdNodos 0 1 0.7 175 161 0 GCGGUUGGA-===========.-\1" |
---|
901 | "VbrFurni\1" " VbrFurni 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
902 | "VblVulni\1" " VblVulni 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
903 | "VbhChole\1" " VbhChole 0 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
904 | "AclPleur\1" " AclPleur 1 1 1.8 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
905 | "PtVVVulg\1" " PtVVVulg 1 1 1.8 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
906 | "DlcTolu2\1" " DlcTolu2 1 2 1.4 175 161 0 GCGGCUGGA-==========NN-N.\1" |
---|
907 | "FrhhPhil\1" " FrhhPhil 1 2 1.4 175 161 0 GCGGCUGGA-==========..-\1" |
---|
908 | "HllHalod\1" " HllHalod 1 2 1.4 175 161 0 GCGGCUGGA-==========..-\1" |
---|
909 | "CPPParap\1" " CPPParap 1 2 1.4 176 162 0 GCGGNUGGA-==========..-\1" |
---|
910 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 175 161 0 AAGAUUAAU-A=C=========-U.\1" |
---|
911 | "LgtLytic\1" " LgtLytic 2 3 2.1 175 161 0 GCGGCUGGA-=========N..-\1" |
---|
912 | "PslFlave\1" " PslFlave 2 3 2.1 175 161 0 GCGGCUGGA-=========...-\1"; |
---|
913 | |
---|
914 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
915 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
916 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
917 | } |
---|
918 | |
---|
919 | { |
---|
920 | const char *arguments[] = { |
---|
921 | "prgnamefake", |
---|
922 | "matchsequence=UCACCUCCUUUC", // contains no N |
---|
923 | NULL, // matchmismatches |
---|
924 | "matchweighted=1", // use weighted mismatches |
---|
925 | }; |
---|
926 | |
---|
927 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
928 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
929 | "PbcAcet2\1" " PbcAcet2 0 1 0.2 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
930 | "PbrPropi\1" " PbrPropi 0 1 0.2 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
931 | "Stsssola\1" " Stsssola 0 1 0.2 175 161 0 GCGGCUGGA-===========.-\1" |
---|
932 | "DcdNodos\1" " DcdNodos 0 1 0.2 175 161 0 GCGGUUGGA-===========.-\1" |
---|
933 | "VbrFurni\1" " VbrFurni 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
934 | "VblVulni\1" " VblVulni 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
935 | "VbhChole\1" " VbhChole 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1"; |
---|
936 | |
---|
937 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
938 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
939 | "PbcAcet2\1" " PbcAcet2 0 1 0.2 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
940 | "PbrPropi\1" " PbrPropi 0 1 0.2 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
941 | "Stsssola\1" " Stsssola 0 1 0.2 175 161 0 GCGGCUGGA-===========.-\1" |
---|
942 | "DcdNodos\1" " DcdNodos 0 1 0.2 175 161 0 GCGGUUGGA-===========.-\1" |
---|
943 | "VbrFurni\1" " VbrFurni 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
944 | "VblVulni\1" " VblVulni 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
945 | "VbhChole\1" " VbhChole 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
946 | "DlcTolu2\1" " DlcTolu2 1 2 0.6 175 161 0 GCGGCUGGA-==========NN-N.\1" |
---|
947 | "FrhhPhil\1" " FrhhPhil 1 2 0.6 175 161 0 GCGGCUGGA-==========..-\1" |
---|
948 | "HllHalod\1" " HllHalod 1 2 0.6 175 161 0 GCGGCUGGA-==========..-\1" |
---|
949 | "CPPParap\1" " CPPParap 1 2 0.6 176 162 0 GCGGNUGGA-==========..-\1" |
---|
950 | "AclPleur\1" " AclPleur 1 1 0.9 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
951 | "PtVVVulg\1" " PtVVVulg 1 1 0.9 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
952 | "LgtLytic\1" " LgtLytic 2 3 1.3 175 161 0 GCGGCUGGA-=========N..-\1" |
---|
953 | "PslFlave\1" " PslFlave 2 3 1.3 175 161 0 GCGGCUGGA-=========...-\1" |
---|
954 | "ClfPerfr\1" " ClfPerfr 2 0 1.3 175 161 0 AAGAUUAAU-A=C=========-U.\1"; |
---|
955 | |
---|
956 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
957 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
958 | "PbcAcet2\1" " PbcAcet2 0 1 0.2 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
959 | "PbrPropi\1" " PbrPropi 0 1 0.2 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
960 | "Stsssola\1" " Stsssola 0 1 0.2 175 161 0 GCGGCUGGA-===========.-\1" |
---|
961 | "DcdNodos\1" " DcdNodos 0 1 0.2 175 161 0 GCGGUUGGA-===========.-\1" |
---|
962 | "VbrFurni\1" " VbrFurni 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
963 | "VblVulni\1" " VblVulni 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
964 | "VbhChole\1" " VbhChole 0 1 0.2 175 161 0 GGCGCUGGA-===========.-\1" |
---|
965 | "DlcTolu2\1" " DlcTolu2 1 2 0.6 175 161 0 GCGGCUGGA-==========NN-N.\1" |
---|
966 | "FrhhPhil\1" " FrhhPhil 1 2 0.6 175 161 0 GCGGCUGGA-==========..-\1" |
---|
967 | "HllHalod\1" " HllHalod 1 2 0.6 175 161 0 GCGGCUGGA-==========..-\1" |
---|
968 | "CPPParap\1" " CPPParap 1 2 0.6 176 162 0 GCGGNUGGA-==========..-\1" |
---|
969 | "AclPleur\1" " AclPleur 1 1 0.9 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
970 | "PtVVVulg\1" " PtVVVulg 1 1 0.9 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
971 | "LgtLytic\1" " LgtLytic 2 3 1.3 175 161 0 GCGGCUGGA-=========N..-\1" |
---|
972 | "PslFlave\1" " PslFlave 2 3 1.3 175 161 0 GCGGCUGGA-=========...-\1" |
---|
973 | "ClfPerfr\1" " ClfPerfr 2 0 1.3 175 161 0 AAGAUUAAU-A=C=========-U.\1" |
---|
974 | "AclPleur\1" " AclPleur 5 0 2.4 50 45 0 GAAGGGAGC-=ug=u=u====G-CCGACGAGU\1" |
---|
975 | "PtVVVulg\1" " PtVVVulg 5 0 2.4 50 45 0 GGAGAAAGC-=ug=u=u===g=-UGACGAGCG\1"; |
---|
976 | |
---|
977 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
978 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
979 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
980 | } |
---|
981 | |
---|
982 | // ---------------------------------------------- |
---|
983 | // do not accept any N-matches as match |
---|
984 | |
---|
985 | { |
---|
986 | const char *arguments[] = { |
---|
987 | "prgnamefake", |
---|
988 | "matchsequence=CANCUCCUUUC", // contains 1 N |
---|
989 | NULL, // matchmismatches |
---|
990 | "matchacceptN=0", |
---|
991 | }; |
---|
992 | |
---|
993 | CCP expectd0 = ""; // nothing matches |
---|
994 | |
---|
995 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUUC'\1" |
---|
996 | "BcSSSS00\1" " BcSSSS00 1 1 0.9 176 162 0 CGGCUGGAU-==C========-U.\1"; |
---|
997 | |
---|
998 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUUC'\1" |
---|
999 | "BcSSSS00\1" " BcSSSS00 1 1 0.9 176 162 0 CGGCUGGAU-==C========-U.\1" |
---|
1000 | "ClfPerfr\1" " ClfPerfr 2 1 2.0 176 162 0 AGAUUAAUA-=CC========-U.\1" |
---|
1001 | "PbcAcet2\1" " PbcAcet2 2 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
1002 | "PbrPropi\1" " PbrPropi 2 2 1.6 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
1003 | "Stsssola\1" " Stsssola 2 2 1.6 176 162 0 CGGCUGGAU-==C=======.-\1" |
---|
1004 | "DcdNodos\1" " DcdNodos 2 2 1.6 176 162 0 CGGUUGGAU-==C=======.-\1" |
---|
1005 | "VbrFurni\1" " VbrFurni 2 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
1006 | "VblVulni\1" " VblVulni 2 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1" |
---|
1007 | "VbhChole\1" " VbhChole 2 2 1.6 176 162 0 GCGCUGGAU-==C=======.-\1"; |
---|
1008 | |
---|
1009 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1010 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
1011 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1012 | } |
---|
1013 | { |
---|
1014 | const char *arguments[] = { |
---|
1015 | "prgnamefake", |
---|
1016 | "matchsequence=UUUCUUU", // contains no N |
---|
1017 | NULL, // matchmismatches |
---|
1018 | "matchacceptN=0", |
---|
1019 | }; |
---|
1020 | |
---|
1021 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'UUUCUUU'\1" |
---|
1022 | "AclPleur\1" " AclPleur 0 0 0.0 54 49 0 GGAGCUUGC-=======-GCCGACGAG\1"; |
---|
1023 | |
---|
1024 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'UUUCUUU'\1" |
---|
1025 | "AclPleur\1" " AclPleur 0 0 0.0 54 49 0 GGAGCUUGC-=======-GCCGACGAG\1" |
---|
1026 | "AclPleur\1" " AclPleur 1 0 0.6 50 45 0 GAAGGGAGC-==g====-CUUUGCCGA\1" |
---|
1027 | "PtVVVulg\1" " PtVVVulg 1 0 0.6 50 45 0 GGAGAAAGC-==g====-CUUGCUGAC\1" |
---|
1028 | "PtVVVulg\1" " PtVVVulg 1 0 0.6 54 49 0 AAAGCUUGC-======g-CUGACGAGC\1" |
---|
1029 | "ClfPerfr\1" " ClfPerfr 1 0 1.1 49 44 0 GCGAUGAAG-====C==-CGGGAAACG\1"; |
---|
1030 | |
---|
1031 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'UUUCUUU'\1" |
---|
1032 | "AclPleur\1" " AclPleur 0 0 0.0 54 49 0 GGAGCUUGC-=======-GCCGACGAG\1" |
---|
1033 | "AclPleur\1" " AclPleur 1 0 0.6 50 45 0 GAAGGGAGC-==g====-CUUUGCCGA\1" |
---|
1034 | "PtVVVulg\1" " PtVVVulg 1 0 0.6 50 45 0 GGAGAAAGC-==g====-CUUGCUGAC\1" |
---|
1035 | "PtVVVulg\1" " PtVVVulg 1 0 0.6 54 49 0 AAAGCUUGC-======g-CUGACGAGC\1" |
---|
1036 | "ClfPerfr\1" " ClfPerfr 1 0 1.1 49 44 0 GCGAUGAAG-====C==-CGGGAAACG\1" |
---|
1037 | "DlcTolu2\1" " DlcTolu2 2 0 1.2 47 42 0 AGAAAGGGA-==g===g-CAAUCCUGA\1" |
---|
1038 | "ClnCorin\1" " ClnCorin 2 0 1.7 48 43 0 AGCGAUGAA-g===C==-CGGGAAUGG\1" |
---|
1039 | "CPPParap\1" " CPPParap 2 0 1.7 48 43 0 AGCGAUGAA-g===C==-CGGGAACGG\1" |
---|
1040 | "HllHalod\1" " HllHalod 2 0 1.7 49 44 0 GAUGGAAGC-==g===C-CAGGCGUCG\1" |
---|
1041 | "DcdNodos\1" " DcdNodos 2 0 1.7 50 45 0 UUAUGUAGC-==g==A=-GUAACCUAG\1" |
---|
1042 | "VbhChole\1" " VbhChole 2 0 1.7 55 50 0 GAGGAACUU-g===C==-GGGUGGCGA\1" |
---|
1043 | "VbrFurni\1" " VbrFurni 2 0 1.7 62 57 0 UUCGGGGGA-===G==g-GGCGGCGAG\1" |
---|
1044 | "VblVulni\1" " VblVulni 2 0 1.7 62 57 0 AGAAACUUG-=====Cg-GGUGGCGAG\1" |
---|
1045 | "VbhChole\1" " VbhChole 2 0 1.7 62 57 0 AGGAACUUG-==C===g-GGUGGCGAG\1" |
---|
1046 | "ClnCorin\1" " ClnCorin 2 0 2.2 49 44 0 GCGAUGAAG-==C===C-GGGAAUGGA\1" |
---|
1047 | "CltBotul\1" " CltBotul 2 0 2.2 49 44 0 GCGAUGAAG-C=====C-GGAAGUGGA\1" |
---|
1048 | "CPPParap\1" " CPPParap 2 0 2.2 49 44 0 GCGAUGAAG-==C===C-GGGAACGGA\1" |
---|
1049 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 50 45 0 CGAUGAAGU-==C===C-GGGAAACGG\1" |
---|
1050 | "VblVulni\1" " VblVulni 2 0 2.2 52 47 0 ACAGAGAAA-C==G===-CUCGGGUGG\1" |
---|
1051 | "BcSSSS00\1" " BcSSSS00 2 0 2.2 179 165 0 CUGGAUCAC-C=C====-CU.\1" |
---|
1052 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 179 165 0 UUAAUACCC-C=C====-CU.\1" |
---|
1053 | "PbcAcet2\1" " PbcAcet2 2 0 2.2 179 165 0 CUGGAUCAC-C=C====-NN.\1" |
---|
1054 | "PbrPropi\1" " PbrPropi 2 0 2.2 179 165 0 CUGGAUCAC-C=C====-NN.\1" |
---|
1055 | "Stsssola\1" " Stsssola 2 0 2.2 179 165 0 CUGGAUCAC-C=C====-.\1" |
---|
1056 | "DcdNodos\1" " DcdNodos 2 0 2.2 179 165 0 UUGGAUCAC-C=C====-.\1" |
---|
1057 | "VbrFurni\1" " VbrFurni 2 0 2.2 179 165 0 CUGGAUCAC-C=C====-.\1" |
---|
1058 | "VblVulni\1" " VblVulni 2 0 2.2 179 165 0 CUGGAUCAC-C=C====-.\1" |
---|
1059 | "VbhChole\1" " VbhChole 2 0 2.2 179 165 0 CUGGAUCAC-C=C====-.\1" |
---|
1060 | "BcSSSS00\1" " BcSSSS00 2 2 1.4 183 169 0 AUCACCUCC-=====..-\1" |
---|
1061 | "ClfPerfr\1" " ClfPerfr 2 2 1.4 183 169 0 UACCCCUCC-=====..-\1"; |
---|
1062 | |
---|
1063 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1064 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
1065 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1066 | } |
---|
1067 | { |
---|
1068 | const char *arguments[] = { |
---|
1069 | "prgnamefake", |
---|
1070 | "matchsequence=UCACCUCCUUUC", // contains no N |
---|
1071 | NULL, // matchmismatches |
---|
1072 | "matchacceptN=0", |
---|
1073 | }; |
---|
1074 | |
---|
1075 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
1076 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" ""; |
---|
1077 | |
---|
1078 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
1079 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
1080 | "PbcAcet2\1" " PbcAcet2 1 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
1081 | "PbrPropi\1" " PbrPropi 1 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
1082 | "Stsssola\1" " Stsssola 1 1 0.7 175 161 0 GCGGCUGGA-===========.-\1" |
---|
1083 | "DcdNodos\1" " DcdNodos 1 1 0.7 175 161 0 GCGGUUGGA-===========.-\1" |
---|
1084 | "VbrFurni\1" " VbrFurni 1 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
1085 | "VblVulni\1" " VblVulni 1 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
1086 | "VbhChole\1" " VbhChole 1 1 0.7 175 161 0 GGCGCUGGA-===========.-\1"; |
---|
1087 | |
---|
1088 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUC'\1" |
---|
1089 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-============-U.\1" |
---|
1090 | "PbcAcet2\1" " PbcAcet2 1 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
1091 | "PbrPropi\1" " PbrPropi 1 1 0.7 175 161 0 GCGGCUGGA-===========N-N.\1" |
---|
1092 | "Stsssola\1" " Stsssola 1 1 0.7 175 161 0 GCGGCUGGA-===========.-\1" |
---|
1093 | "DcdNodos\1" " DcdNodos 1 1 0.7 175 161 0 GCGGUUGGA-===========.-\1" |
---|
1094 | "VbrFurni\1" " VbrFurni 1 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
1095 | "VblVulni\1" " VblVulni 1 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
1096 | "VbhChole\1" " VbhChole 1 1 0.7 175 161 0 GGCGCUGGA-===========.-\1" |
---|
1097 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 175 161 0 AAGAUUAAU-A=C=========-U.\1" |
---|
1098 | "AclPleur\1" " AclPleur 2 1 1.8 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
1099 | "PtVVVulg\1" " PtVVVulg 2 1 1.8 175 161 0 GCGGUUGGA-==========A.-\1" |
---|
1100 | "DlcTolu2\1" " DlcTolu2 2 2 1.4 175 161 0 GCGGCUGGA-==========NN-N.\1" |
---|
1101 | "FrhhPhil\1" " FrhhPhil 2 2 1.4 175 161 0 GCGGCUGGA-==========..-\1" |
---|
1102 | "HllHalod\1" " HllHalod 2 2 1.4 175 161 0 GCGGCUGGA-==========..-\1" |
---|
1103 | "CPPParap\1" " CPPParap 2 2 1.4 176 162 0 GCGGNUGGA-==========..-\1"; |
---|
1104 | |
---|
1105 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1106 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
1107 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1108 | } |
---|
1109 | { |
---|
1110 | const char *arguments[] = { |
---|
1111 | "prgnamefake", |
---|
1112 | "matchsequence=UCACCUCCUUUCU", // contains no N |
---|
1113 | NULL, // matchmismatches |
---|
1114 | "matchacceptN=0", |
---|
1115 | }; |
---|
1116 | |
---|
1117 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUCU'\1" |
---|
1118 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-=============-.\1"; |
---|
1119 | |
---|
1120 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUCU'\1" |
---|
1121 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-=============-.\1" |
---|
1122 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 175 161 0 AAGAUUAAU-A=C==========-.\1" |
---|
1123 | "PbcAcet2\1" " PbcAcet2 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1124 | "PbrPropi\1" " PbrPropi 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1125 | "Stsssola\1" " Stsssola 2 2 1.4 175 161 0 GCGGCUGGA-===========..-\1" |
---|
1126 | "DcdNodos\1" " DcdNodos 2 2 1.4 175 161 0 GCGGUUGGA-===========..-\1" |
---|
1127 | "VbrFurni\1" " VbrFurni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1128 | "VblVulni\1" " VblVulni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1129 | "VbhChole\1" " VbhChole 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1"; |
---|
1130 | |
---|
1131 | CCP expectd3 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUCU'\1" |
---|
1132 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-=============-.\1" |
---|
1133 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 175 161 0 AAGAUUAAU-A=C==========-.\1" |
---|
1134 | "PbcAcet2\1" " PbcAcet2 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1135 | "PbrPropi\1" " PbrPropi 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1136 | "Stsssola\1" " Stsssola 2 2 1.4 175 161 0 GCGGCUGGA-===========..-\1" |
---|
1137 | "DcdNodos\1" " DcdNodos 2 2 1.4 175 161 0 GCGGUUGGA-===========..-\1" |
---|
1138 | "VbrFurni\1" " VbrFurni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1139 | "VblVulni\1" " VblVulni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1140 | "VbhChole\1" " VbhChole 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1141 | "AclPleur\1" " AclPleur 3 2 2.5 175 161 0 GCGGUUGGA-==========A..-\1" |
---|
1142 | "PtVVVulg\1" " PtVVVulg 3 2 2.5 175 161 0 GCGGUUGGA-==========A..-\1" |
---|
1143 | "DlcTolu2\1" " DlcTolu2 3 3 2.1 175 161 0 GCGGCUGGA-==========NNN-.\1" |
---|
1144 | "FrhhPhil\1" " FrhhPhil 3 3 2.1 175 161 0 GCGGCUGGA-==========...-\1" |
---|
1145 | "HllHalod\1" " HllHalod 3 3 2.1 175 161 0 GCGGCUGGA-==========...-\1" |
---|
1146 | "CPPParap\1" " CPPParap 3 3 2.1 176 162 0 GCGGNUGGA-==========...-\1"; |
---|
1147 | |
---|
1148 | CCP expectd4 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUCU'\1" |
---|
1149 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-=============-.\1" |
---|
1150 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 175 161 0 AAGAUUAAU-A=C==========-.\1" |
---|
1151 | "PbcAcet2\1" " PbcAcet2 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1152 | "PbrPropi\1" " PbrPropi 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1153 | "Stsssola\1" " Stsssola 2 2 1.4 175 161 0 GCGGCUGGA-===========..-\1" |
---|
1154 | "DcdNodos\1" " DcdNodos 2 2 1.4 175 161 0 GCGGUUGGA-===========..-\1" |
---|
1155 | "VbrFurni\1" " VbrFurni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1156 | "VblVulni\1" " VblVulni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1157 | "VbhChole\1" " VbhChole 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1158 | "AclPleur\1" " AclPleur 3 2 2.5 175 161 0 GCGGUUGGA-==========A..-\1" |
---|
1159 | "PtVVVulg\1" " PtVVVulg 3 2 2.5 175 161 0 GCGGUUGGA-==========A..-\1" |
---|
1160 | "DlcTolu2\1" " DlcTolu2 3 3 2.1 175 161 0 GCGGCUGGA-==========NNN-.\1" |
---|
1161 | "FrhhPhil\1" " FrhhPhil 3 3 2.1 175 161 0 GCGGCUGGA-==========...-\1" |
---|
1162 | "HllHalod\1" " HllHalod 3 3 2.1 175 161 0 GCGGCUGGA-==========...-\1" |
---|
1163 | "CPPParap\1" " CPPParap 3 3 2.1 176 162 0 GCGGNUGGA-==========...-\1" |
---|
1164 | "LgtLytic\1" " LgtLytic 4 4 2.8 175 161 0 GCGGCUGGA-=========N...-\1" |
---|
1165 | "PslFlave\1" " PslFlave 4 4 2.8 175 161 0 GCGGCUGGA-=========....-\1"; |
---|
1166 | |
---|
1167 | CCP expectd5 = " name---- fullname mis N_mis wmis pos ecoli rev 'UCACCUCCUUUCU'\1" |
---|
1168 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 175 161 0 GCGGCUGGA-=============-.\1" |
---|
1169 | "ClfPerfr\1" " ClfPerfr 2 0 2.2 175 161 0 AAGAUUAAU-A=C==========-.\1" |
---|
1170 | "PbcAcet2\1" " PbcAcet2 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1171 | "PbrPropi\1" " PbrPropi 2 2 1.4 175 161 0 GCGGCUGGA-===========NN-.\1" |
---|
1172 | "Stsssola\1" " Stsssola 2 2 1.4 175 161 0 GCGGCUGGA-===========..-\1" |
---|
1173 | "DcdNodos\1" " DcdNodos 2 2 1.4 175 161 0 GCGGUUGGA-===========..-\1" |
---|
1174 | "VbrFurni\1" " VbrFurni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1175 | "VblVulni\1" " VblVulni 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1176 | "VbhChole\1" " VbhChole 2 2 1.4 175 161 0 GGCGCUGGA-===========..-\1" |
---|
1177 | "AclPleur\1" " AclPleur 3 2 2.5 175 161 0 GCGGUUGGA-==========A..-\1" |
---|
1178 | "PtVVVulg\1" " PtVVVulg 3 2 2.5 175 161 0 GCGGUUGGA-==========A..-\1" |
---|
1179 | "DlcTolu2\1" " DlcTolu2 3 3 2.1 175 161 0 GCGGCUGGA-==========NNN-.\1" |
---|
1180 | "FrhhPhil\1" " FrhhPhil 3 3 2.1 175 161 0 GCGGCUGGA-==========...-\1" |
---|
1181 | "HllHalod\1" " HllHalod 3 3 2.1 175 161 0 GCGGCUGGA-==========...-\1" |
---|
1182 | "CPPParap\1" " CPPParap 3 3 2.1 176 162 0 GCGGNUGGA-==========...-\1" |
---|
1183 | "LgtLytic\1" " LgtLytic 4 4 2.8 175 161 0 GCGGCUGGA-=========N...-\1" |
---|
1184 | "PslFlave\1" " PslFlave 4 4 2.8 175 161 0 GCGGCUGGA-=========....-\1" |
---|
1185 | "PtVVVulg\1" " PtVVVulg 5 0 2.6 50 45 0 GGAGAAAGC-=ug=u=u===g==-GACGAGCGG\1" |
---|
1186 | "AclPleur\1" " AclPleur 5 0 3.5 46 41 0 ACGGGAAGG-gag=u=G======-UUGCCGACG\1" |
---|
1187 | "PtVVVulg\1" " PtVVVulg 5 0 4.0 45 40 0 ...AGGAGA-Aag=u=G======-UGCUGACGA\1" |
---|
1188 | "VblVulni\1" " VblVulni 5 0 4.3 48 43 0 CAGCACAGA-ga=a==uG=====-CGGGUGGCG\1"; |
---|
1189 | |
---|
1190 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
1191 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1192 | arguments[2] = "matchmismatches=3"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd3); |
---|
1193 | arguments[2] = "matchmismatches=4"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd4); |
---|
1194 | arguments[2] = "matchmismatches=5"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd5); |
---|
1195 | } |
---|
1196 | |
---|
1197 | // ---------------------------------- |
---|
1198 | // accept several N-matches |
---|
1199 | |
---|
1200 | { |
---|
1201 | const char *arguments[] = { |
---|
1202 | "prgnamefake", |
---|
1203 | "matchsequence=CANCUCCUUNC", // contains 2 N |
---|
1204 | NULL, // matchmismatches |
---|
1205 | "matchacceptN=2", |
---|
1206 | "matchlimitN=4", |
---|
1207 | }; |
---|
1208 | |
---|
1209 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUNC'\1" |
---|
1210 | "BcSSSS00\1" " BcSSSS00 0 2 1.7 176 162 0 CGGCUGGAU-==C======U=-U.\1"; |
---|
1211 | |
---|
1212 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUNC'\1" |
---|
1213 | "BcSSSS00\1" " BcSSSS00 0 2 1.7 176 162 0 CGGCUGGAU-==C======U=-U.\1" |
---|
1214 | "ClfPerfr\1" " ClfPerfr 1 2 2.8 176 162 0 AGAUUAAUA-=CC======U=-U.\1" |
---|
1215 | "DlcTolu2\1" " DlcTolu2 1 3 2.4 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
1216 | "FrhhPhil\1" " FrhhPhil 1 3 2.4 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
1217 | "HllHalod\1" " HllHalod 1 3 2.4 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
1218 | "CPPParap\1" " CPPParap 1 3 2.4 177 163 0 CGGNUGGAU-==C======..-\1" |
---|
1219 | "PbcAcet2\1" " PbcAcet2 1 3 2.4 176 162 0 CGGCUGGAU-==C======UN-N.\1" |
---|
1220 | "PbrPropi\1" " PbrPropi 1 3 2.4 176 162 0 CGGCUGGAU-==C======UN-N.\1" |
---|
1221 | "Stsssola\1" " Stsssola 1 3 2.4 176 162 0 CGGCUGGAU-==C======U.-\1" |
---|
1222 | "DcdNodos\1" " DcdNodos 1 3 2.4 176 162 0 CGGUUGGAU-==C======U.-\1" |
---|
1223 | "VbrFurni\1" " VbrFurni 1 3 2.4 176 162 0 GCGCUGGAU-==C======U.-\1" |
---|
1224 | "VblVulni\1" " VblVulni 1 3 2.4 176 162 0 GCGCUGGAU-==C======U.-\1" |
---|
1225 | "VbhChole\1" " VbhChole 1 3 2.4 176 162 0 GCGCUGGAU-==C======U.-\1" |
---|
1226 | "AclPleur\1" " AclPleur 1 3 2.5 176 162 0 CGGUUGGAU-==C======A.-\1" |
---|
1227 | "PtVVVulg\1" " PtVVVulg 1 3 2.5 176 162 0 CGGUUGGAU-==C======A.-\1"; |
---|
1228 | |
---|
1229 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCUCCUUNC'\1" |
---|
1230 | "BcSSSS00\1" " BcSSSS00 0 2 1.7 176 162 0 CGGCUGGAU-==C======U=-U.\1" |
---|
1231 | "ClfPerfr\1" " ClfPerfr 1 2 2.8 176 162 0 AGAUUAAUA-=CC======U=-U.\1" |
---|
1232 | "DlcTolu2\1" " DlcTolu2 1 3 2.4 176 162 0 CGGCUGGAU-==C=======N-N.\1" |
---|
1233 | "FrhhPhil\1" " FrhhPhil 1 3 2.4 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
1234 | "HllHalod\1" " HllHalod 1 3 2.4 176 162 0 CGGCUGGAU-==C======..-\1" |
---|
1235 | "CPPParap\1" " CPPParap 1 3 2.4 177 163 0 CGGNUGGAU-==C======..-\1" |
---|
1236 | "PbcAcet2\1" " PbcAcet2 1 3 2.4 176 162 0 CGGCUGGAU-==C======UN-N.\1" |
---|
1237 | "PbrPropi\1" " PbrPropi 1 3 2.4 176 162 0 CGGCUGGAU-==C======UN-N.\1" |
---|
1238 | "Stsssola\1" " Stsssola 1 3 2.4 176 162 0 CGGCUGGAU-==C======U.-\1" |
---|
1239 | "DcdNodos\1" " DcdNodos 1 3 2.4 176 162 0 CGGUUGGAU-==C======U.-\1" |
---|
1240 | "VbrFurni\1" " VbrFurni 1 3 2.4 176 162 0 GCGCUGGAU-==C======U.-\1" |
---|
1241 | "VblVulni\1" " VblVulni 1 3 2.4 176 162 0 GCGCUGGAU-==C======U.-\1" |
---|
1242 | "VbhChole\1" " VbhChole 1 3 2.4 176 162 0 GCGCUGGAU-==C======U.-\1" |
---|
1243 | "AclPleur\1" " AclPleur 1 3 2.5 176 162 0 CGGUUGGAU-==C======A.-\1" |
---|
1244 | "PtVVVulg\1" " PtVVVulg 1 3 2.5 176 162 0 CGGUUGGAU-==C======A.-\1"; |
---|
1245 | |
---|
1246 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1247 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
1248 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1249 | } |
---|
1250 | |
---|
1251 | { |
---|
1252 | const char *arguments[] = { |
---|
1253 | "prgnamefake", |
---|
1254 | "matchsequence=GAGCGGUCAG", // similar to a region where dots occur in seqdata |
---|
1255 | NULL, // matchmismatches |
---|
1256 | "matchacceptN=0", |
---|
1257 | "matchlimitN=4", |
---|
1258 | }; |
---|
1259 | |
---|
1260 | CCP expectd0 = ""; |
---|
1261 | |
---|
1262 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'GAGCGGUCAG'\1" |
---|
1263 | "BcSSSS00\1" " BcSSSS00 1 0 1.1 25 21 0 GAUCAAGUC-======A===-AUGGGAGCU\1"; |
---|
1264 | |
---|
1265 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'GAGCGGUCAG'\1" |
---|
1266 | "BcSSSS00\1" " BcSSSS00 1 0 1.1 25 21 0 GAUCAAGUC-======A===-AUGGGAGCU\1" |
---|
1267 | "Bl0LLL00\1" " Bl0LLL00 2 0 2.2 25 21 0 GAUCAAGUC-======A=C=-ACGGGAGCU\1"; |
---|
1268 | |
---|
1269 | CCP expectd3 = " name---- fullname mis N_mis wmis pos ecoli rev 'GAGCGGUCAG'\1" |
---|
1270 | "BcSSSS00\1" " BcSSSS00 1 0 1.1 25 21 0 GAUCAAGUC-======A===-AUGGGAGCU\1" |
---|
1271 | "Bl0LLL00\1" " Bl0LLL00 2 0 2.2 25 21 0 GAUCAAGUC-======A=C=-ACGGGAGCU\1" |
---|
1272 | "VbrFurni\1" " VbrFurni 3 0 2.4 68 60 0 GGAUUUGUU-=g====CG==-CGGCGGACG\1" |
---|
1273 | "FrhhPhil\1" " FrhhPhil 3 0 2.8 82 70 0 ACGAGUGGC-=gA===C===-UUGGAAACG\1" |
---|
1274 | "ClfPerfr\1" " ClfPerfr 3 0 3.2 86 74 0 CGGCGGGAC-=g==CU====-AACCUGCGG\1" |
---|
1275 | "HllHalod\1" " HllHalod 3 0 3.6 25 21 0 GAUCAAGUC-======Aa=C-GAUGGAAGC\1" |
---|
1276 | "DlcTolu2\1" " DlcTolu2 3 0 3.6 95 83 0 GGACUGCCC-==Aa==A===-CUAAUACCG\1" |
---|
1277 | "FrhhPhil\1" " FrhhPhil 3 0 4.0 25 21 0 GAUCAAGUC-==A====a=C-AGGUCUUCG\1" |
---|
1278 | "AclPleur\1" " AclPleur 3 0 4.0 29 24 0 GAUCAAGUC-==A====a=C-GGGAAGGGA\1" |
---|
1279 | "ClnCorin\1" " ClnCorin 3 0 4.1 25 21 0 GAUCAAGUC-=====A=G=A-GUUCCUUCG\1" |
---|
1280 | "CltBotul\1" " CltBotul 3 0 4.1 25 21 0 .AUCAAGUC-=====A=G=A-GCUUCUUCG\1" |
---|
1281 | "CPPParap\1" " CPPParap 3 0 4.1 25 21 0 GAUCAAGUC-=====A=G=A-GUUCCUUCG\1" |
---|
1282 | "ClfPerfr\1" " ClfPerfr 3 0 4.1 25 21 0 GAUCAAGUC-=====A=G=A-GUUUCCUUC\1" |
---|
1283 | "DlcTolu2\1" " DlcTolu2 3 0 4.1 157 143 0 GUAGCCGUU-===GAA====-CGGCUGGAU\1" |
---|
1284 | "PslFlave\1" " PslFlave 3 3 2.4 25 21 0 GAUCAAGUC-=======...-<more>\1" |
---|
1285 | "PtVVVulg\1" " PtVVVulg 3 3 2.4 29 24 0 GAUCAAGUC-=======...-<more>\1"; |
---|
1286 | |
---|
1287 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1288 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
1289 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1290 | arguments[2] = "matchmismatches=3"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd3); |
---|
1291 | } |
---|
1292 | |
---|
1293 | { |
---|
1294 | const char *arguments[] = { |
---|
1295 | "prgnamefake", |
---|
1296 | "matchsequence=GAGCGGUCAGGAG", // as above, but continues behind '...' |
---|
1297 | NULL, // matchmismatches |
---|
1298 | "matchweighted=1", // use weighted mismatches |
---|
1299 | }; |
---|
1300 | |
---|
1301 | CCP expectd2 = ""; |
---|
1302 | CCP expectd3 = " name---- fullname mis N_mis wmis pos ecoli rev 'GAGCGGUCAGGAG'\1" |
---|
1303 | "ClnCorin\1" " ClnCorin 6 0 3.4 77 66 0 AUGGAUUAG-Cg====A=g==CC-UUUCGAAAG\1" |
---|
1304 | "CltBotul\1" " CltBotul 6 0 3.4 77 66 0 GUGGAUUAG-Cg====A=g==CC-UUUCGAAAG\1" |
---|
1305 | "CPPParap\1" " CPPParap 6 0 3.4 77 66 0 ACGGAUUAG-Cg====A=g==CC-UUCCGAAAG\1" |
---|
1306 | "BcSSSS00\1" " BcSSSS00 3 0 3.4 25 21 0 GAUCAAGUC-======A===AU=-GGAGCUUGC\1"; |
---|
1307 | |
---|
1308 | CCP expectd4 = " name---- fullname mis N_mis wmis pos ecoli rev 'GAGCGGUCAGGAG'\1" |
---|
1309 | "ClnCorin\1" " ClnCorin 6 0 3.4 77 66 0 AUGGAUUAG-Cg====A=g==CC-UUUCGAAAG\1" |
---|
1310 | "CltBotul\1" " CltBotul 6 0 3.4 77 66 0 GUGGAUUAG-Cg====A=g==CC-UUUCGAAAG\1" |
---|
1311 | "CPPParap\1" " CPPParap 6 0 3.4 77 66 0 ACGGAUUAG-Cg====A=g==CC-UUCCGAAAG\1" |
---|
1312 | "BcSSSS00\1" " BcSSSS00 3 0 3.4 25 21 0 GAUCAAGUC-======A===AU=-GGAGCUUGC\1" |
---|
1313 | "ClfPerfr\1" " ClfPerfr 6 0 3.9 121 108 0 AUCAUAAUG-C====A=ug==gU-GAAGUCGUA\1" |
---|
1314 | "ClnCorin\1" " ClnCorin 6 0 3.9 122 109 0 CGCAUAAGA-C====A=ug==gU-GAAGUCGUA\1" |
---|
1315 | "CltBotul\1" " CltBotul 6 0 3.9 122 109 0 CUCAUAAGA-C====A=ug==gU-GAAGUCGUA\1" |
---|
1316 | "CPPParap\1" " CPPParap 6 0 3.9 122 109 0 GCAUAAGAU-C====A=ug==gU-AAGUCGUAA\1" |
---|
1317 | "DcdNodos\1" " DcdNodos 6 0 4.2 77 66 0 GUAACCUAG-Ug====A=g=AC=-UAUGGAAAC\1" |
---|
1318 | "PsAAAA00\1" " PsAAAA00 6 0 4.2 77 66 0 UGGAUUCAG-Cg====A=g=AC=-UCCGGAAAC\1" |
---|
1319 | "PslFlave\1" " PslFlave 6 0 4.2 77 66 0 CUGAUUCAG-Cg====A=g=AC=-UUUCGAAAG\1" |
---|
1320 | "FrhhPhil\1" " FrhhPhil 5 0 4.2 149 135 0 UAACAAUGG-U===C==ag===A-CCUGCGGCU\1" |
---|
1321 | "AclPleur\1" " AclPleur 4 0 4.3 29 24 0 GAUCAAGUC-==A====a=C=g=-AAGGGAGCU\1" |
---|
1322 | "PbcAcet2\1" " PbcAcet2 6 0 4.3 149 135 0 GUAACAAGG-U===C==ag==gA-ACCUGCGGC\1" |
---|
1323 | "PbrPropi\1" " PbrPropi 6 0 4.3 149 135 0 GUAACAAGG-U===C==ag==gA-ACCUGCGGC\1" |
---|
1324 | "Stsssola\1" " Stsssola 6 0 4.3 149 135 0 GUAACAAGG-U===C==ag==gA-ACCUGCGGC\1" |
---|
1325 | "LgtLytic\1" " LgtLytic 6 0 4.3 149 135 0 GUAACAAGG-U===C==ag==gA-ACCUGCGGC\1" |
---|
1326 | "PslFlave\1" " PslFlave 6 0 4.3 149 135 0 GUAACAAGG-U===C==ag==gA-ACCUGCGGC\1" |
---|
1327 | "HllHalod\1" " HllHalod 6 0 4.3 149 135 0 GUAACAAGG-U===C==ag==gA-ACCUGCGGC\1" |
---|
1328 | "VbrFurni\1" " VbrFurni 5 0 4.4 68 60 0 GGAUUUGUU-=g====CG==Cg=-CGGACGGAC\1" |
---|
1329 | "AclPleur\1" " AclPleur 6 0 4.4 35 30 0 GUCGAACGG-U=A===ga===gA-GCUUGCUUU\1" |
---|
1330 | "PslFlave\1" " PslFlave 6 6 4.4 25 21 0 GAUCAAGUC-=======......-<more>\1" |
---|
1331 | "PtVVVulg\1" " PtVVVulg 6 6 4.4 29 24 0 GAUCAAGUC-=======......-<more>\1" |
---|
1332 | "VbrFurni\1" " VbrFurni 6 0 4.4 149 135 0 GUAACAAGG-U====C=ag==gA-ACCUGGCGC\1" |
---|
1333 | "VblVulni\1" " VblVulni 6 0 4.4 149 135 0 GUAACAAGG-U====C=ag==gA-ACCUGGCGC\1" |
---|
1334 | "VbhChole\1" " VbhChole 6 0 4.4 149 135 0 GUAACAAGG-U====C=ag==gA-ACCUGGCGC\1"; |
---|
1335 | |
---|
1336 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1337 | arguments[2] = "matchmismatches=3"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd3); |
---|
1338 | arguments[2] = "matchmismatches=4"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd4); |
---|
1339 | } |
---|
1340 | |
---|
1341 | // -------------------------- |
---|
1342 | // truncate results |
---|
1343 | |
---|
1344 | { |
---|
1345 | const char *arguments[] = { |
---|
1346 | "prgnamefake", |
---|
1347 | "matchsequence=CANCNCNNUNC", // contains 5N |
---|
1348 | NULL, // matchmismatches |
---|
1349 | "matchacceptN=5", |
---|
1350 | "matchlimitN=7", |
---|
1351 | "matchmaxresults=5", |
---|
1352 | }; |
---|
1353 | |
---|
1354 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCNCNNUNC'\1" |
---|
1355 | "BcSSSS00\1" " BcSSSS00 0 5 4.2 176 162 0 CGGCUGGAU-==C=U=CU=U=-U.\1"; |
---|
1356 | |
---|
1357 | // many hits are truncated here: |
---|
1358 | CCP expectd1 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCNCNNUNC'\1" |
---|
1359 | "DlcTolu2\1" " DlcTolu2 1 6 4.9 176 162 0 CGGCUGGAU-==C=U=CU==N-N.\1" |
---|
1360 | "FrhhPhil\1" " FrhhPhil 1 6 4.9 176 162 0 CGGCUGGAU-==C=U=CU=..-\1" |
---|
1361 | "HllHalod\1" " HllHalod 1 6 4.9 176 162 0 CGGCUGGAU-==C=U=CU=..-\1" |
---|
1362 | "CPPParap\1" " CPPParap 1 6 4.9 177 163 0 CGGNUGGAU-==C=U=CU=..-\1" |
---|
1363 | "AclPleur\1" " AclPleur 1 6 5.0 176 162 0 CGGUUGGAU-==C=U=CU=A.-\1"; |
---|
1364 | |
---|
1365 | // many hits are truncated here: |
---|
1366 | CCP expectd2 = " name---- fullname mis N_mis wmis pos ecoli rev 'CANCNCNNUNC'\1" |
---|
1367 | "HllHalod\1" " HllHalod 2 5 5.1 45 40 0 AAACGAUGG-a=G=UuGC=U=-CAGGCGUCG\1" |
---|
1368 | "VblVulni\1" " VblVulni 2 5 5.4 49 44 0 AGCACAGAG-a=A=UuGU=U=-UCGGGUGGC\1" |
---|
1369 | "VbrFurni\1" " VbrFurni 2 5 5.7 40 35 0 CGGCAGCGA-==A=AuUGAA=-CUUCGGGGG\1" |
---|
1370 | "LgtLytic\1" " LgtLytic 2 5 6.2 101 89 0 GGGGAAACU-==AGCuAA=A=-CGCAUAAUC\1" |
---|
1371 | "ClfPerfr\1" " ClfPerfr 2 5 6.5 172 158 0 AGGAAGAUU-a=UaC=CC=C=-UUUCU.\1"; |
---|
1372 | |
---|
1373 | arguments[2] = "matchmismatches=0"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1374 | arguments[2] = "matchmismatches=1"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd1); |
---|
1375 | arguments[2] = "matchmismatches=2"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd2); |
---|
1376 | } |
---|
1377 | |
---|
1378 | // ------------------------------------------------------------- |
---|
1379 | // tests related to http://bugs.arb-home.de/ticket/410 |
---|
1380 | { |
---|
1381 | const char *arguments[] = { |
---|
1382 | "prgnamefake", |
---|
1383 | "matchsequence=ACGGACUCCGGGAAACCGGGGCUAAUACC", // length=29 |
---|
1384 | NULL, // matchmismatches |
---|
1385 | "matchacceptN=5", |
---|
1386 | "matchlimitN=7", |
---|
1387 | "matchmaxresults=10", |
---|
1388 | }; |
---|
1389 | |
---|
1390 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'ACGGACUCCGGGAAACCGGGGCUAAUACC'\1" |
---|
1391 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 84 72 0 UAGCGGCGG-=============================-GGAUGGUGA\1" |
---|
1392 | "Bl0LLL00\1" " Bl0LLL00 0 0 0.0 84 72 0 CAGCGGCGG-=============================-GGAUGCUGA\1" |
---|
1393 | "AclPleur\1" " AclPleur 4 0 4.6 84 72 0 GAGUGGCGG-=======a========u=UA=========-GCGUAAUCA\1" |
---|
1394 | "PtVVVulg\1" " PtVVVulg 4 0 5.1 84 72 0 GAGCGGCGG-=======a=U======G=U==========-GCAUGACCA\1" |
---|
1395 | "DsssDesu\1" " DsssDesu 5 0 5.3 84 72 0 GAGUGGCGC-========u=C====Gu==A=========-GGAUACAGA\1" |
---|
1396 | "PsAAAA00\1" " PsAAAA00 5 0 5.3 84 72 0 CAGCGGCGG-======gu=C======G==C=========-GCAUACGCA\1"; |
---|
1397 | |
---|
1398 | arguments[2] = "matchmismatches=5"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1399 | } |
---|
1400 | { |
---|
1401 | const char *arguments[] = { |
---|
1402 | "prgnamefake", |
---|
1403 | "matchsequence=ACGGACUCCGGGAAACCGGGGCUAAUACCGGAUGGUGA", // length=38 |
---|
1404 | NULL, // matchmismatches |
---|
1405 | "matchacceptN=5", |
---|
1406 | "matchlimitN=7", |
---|
1407 | "matchmaxresults=10", |
---|
1408 | }; |
---|
1409 | |
---|
1410 | CCP expectd0 = " name---- fullname mis N_mis wmis pos ecoli rev 'ACGGACUCCGGGAAACCGGGGCUAAUACCGGAUGGUGA'\1" |
---|
1411 | "BcSSSS00\1" " BcSSSS00 0 0 0.0 84 72 0 UAGCGGCGG-======================================-UGAUUGGGG\1" |
---|
1412 | "Bl0LLL00\1" " Bl0LLL00 1 0 1.5 84 72 0 CAGCGGCGG-==================================C===-UGAUUGGGG\1"; |
---|
1413 | |
---|
1414 | arguments[2] = "matchmismatches=18"; TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expectd0); |
---|
1415 | } |
---|
1416 | } |
---|
1417 | |
---|
1418 | static char *extract_locations(const char *probe_design_result) { |
---|
1419 | const char *Target = strstr(probe_design_result, "\nTarget"); |
---|
1420 | if (Target) { |
---|
1421 | const char *designed = strchr(Target+7, '\n'); |
---|
1422 | if (designed) { |
---|
1423 | ++designed; |
---|
1424 | |
---|
1425 | GBS_strstruct result(300); |
---|
1426 | RegExpr reg_designed("^[A-Z]+" |
---|
1427 | "[[:space:]]+[0-9]+" |
---|
1428 | "[[:space:]]+([A-Z][=+-])" // subexpr #1 (loc+-=) |
---|
1429 | "[[:space:]]*([0-9]+)", // subexpr #2 (abs or locrel) |
---|
1430 | true); |
---|
1431 | |
---|
1432 | |
---|
1433 | while (designed) { |
---|
1434 | const char *eol = strchr(designed, '\n'); |
---|
1435 | const RegMatch *match = reg_designed.match(designed); if (!match) break; |
---|
1436 | |
---|
1437 | match = reg_designed.subexpr_match(1); if (!match) break; |
---|
1438 | std::string loc = match->extract(designed); |
---|
1439 | |
---|
1440 | match = reg_designed.subexpr_match(2); if (!match) break; |
---|
1441 | std::string pos = match->extract(designed); |
---|
1442 | |
---|
1443 | result.cat(loc.c_str()); |
---|
1444 | result.cat(pos.c_str()); |
---|
1445 | |
---|
1446 | designed = eol ? eol+1 : NULL; |
---|
1447 | } |
---|
1448 | |
---|
1449 | return result.release(); |
---|
1450 | } |
---|
1451 | } |
---|
1452 | return strdup("can't extract"); |
---|
1453 | } |
---|
1454 | |
---|
1455 | inline const char *next_line(const char *this_line) { |
---|
1456 | const char *lf = strchr(this_line, '\n'); |
---|
1457 | return (lf && lf[1] && strchr("ACGTU", lf[1])) ? lf+1 : NULL; |
---|
1458 | } |
---|
1459 | inline int count_hits(const char *design_result) { |
---|
1460 | const char *target = strstr(design_result, "\nTarget"); |
---|
1461 | if (target) { |
---|
1462 | const char *hit = next_line(target+1); |
---|
1463 | int hits = 0; |
---|
1464 | |
---|
1465 | while (hit) { |
---|
1466 | ++hits; |
---|
1467 | hit = next_line(hit); |
---|
1468 | } |
---|
1469 | return hits; |
---|
1470 | } |
---|
1471 | return -1; |
---|
1472 | } |
---|
1473 | |
---|
1474 | void TEST_SLOW_design_probe() { |
---|
1475 | // test here runs versus database ../UNIT_TESTER/run/TEST_pt_src.arb |
---|
1476 | |
---|
1477 | bool use_gene_ptserver = false; |
---|
1478 | { |
---|
1479 | int hits_len_18; |
---|
1480 | { |
---|
1481 | const char *arguments[] = { |
---|
1482 | "prgnamefake", |
---|
1483 | "designnames=ClnCorin#CltBotul#CPPParap#ClfPerfr", |
---|
1484 | "designmintargets=100", |
---|
1485 | }; |
---|
1486 | const char *expected = |
---|
1487 | "Probe design parameters:\n" |
---|
1488 | "Length of probe 18\n" |
---|
1489 | "Temperature [ 0.0 -400.0]\n" |
---|
1490 | "GC-content [30.0 - 80.0]\n" |
---|
1491 | "E.Coli position [any]\n" |
---|
1492 | "Max. nongroup hits 0\n" |
---|
1493 | "Min. group hits 100% (max. rejected coverage: 75%)\n" |
---|
1494 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1495 | "CGAAAGGAAGAUUAAUAC 18 A=94 82 77 4 33.3 48.0 GUAUUAAUCUUCCUUUCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1496 | "GAAAGGAAGAUUAAUACC 18 A+ 1 83 77 4 33.3 48.0 GGUAUUAAUCUUCCUUUC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1497 | "UCAAGUCGAGCGAUGAAG 18 B=18 17 61 4 50.0 54.0 CUUCAUCGCUCGACUUGA | - - - - - - - - - - - - - - - 2 2 2 2 2\n" |
---|
1498 | "AUCAAGUCGAGCGAUGAA 18 B- 1 16 45 4 44.4 52.0 UUCAUCGCUCGACUUGAU | - - - - - - - - - - - 2 2 2 2 2 2 2 2 2\n"; |
---|
1499 | |
---|
1500 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1501 | hits_len_18 = count_hits(expected); |
---|
1502 | TEST_EXPECT_EQUAL(hits_len_18, 4); |
---|
1503 | |
---|
1504 | // test extraction of positions: |
---|
1505 | { |
---|
1506 | char *positions = extract_locations(expected); |
---|
1507 | TEST_EXPECT_EQUAL(positions, "A=94A+1B=18B-1"); |
---|
1508 | free(positions); |
---|
1509 | } |
---|
1510 | } |
---|
1511 | // same as above with probelength 17 |
---|
1512 | int hits_len_17; |
---|
1513 | { |
---|
1514 | const char *arguments[] = { |
---|
1515 | "prgnamefake", |
---|
1516 | "designnames=ClnCorin#CltBotul#CPPParap#ClfPerfr", |
---|
1517 | "designmintargets=100", |
---|
1518 | "designprobelength=17", |
---|
1519 | }; |
---|
1520 | const char *expected = |
---|
1521 | "Probe design parameters:\n" |
---|
1522 | "Length of probe 17\n" |
---|
1523 | "Temperature [ 0.0 -400.0]\n" |
---|
1524 | "GC-content [30.0 - 80.0]\n" |
---|
1525 | "E.Coli position [any]\n" |
---|
1526 | "Max. nongroup hits 0\n" |
---|
1527 | "Min. group hits 100% (max. rejected coverage: 75%)\n" |
---|
1528 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1529 | "CAAGUCGAGCGAUGAAG 17 A=19 18 65 4 52.9 52.0 CUUCAUCGCUCGACUUG | - - - - - - - - - - - - - - - - 2 2 2 2\n" |
---|
1530 | "UCAAGUCGAGCGAUGAA 17 A- 1 17 49 4 47.1 50.0 UUCAUCGCUCGACUUGA | - - - - - - - - - - - - 2 2 2 2 2 2 2 2\n" |
---|
1531 | "AUCAAGUCGAGCGAUGA 17 A- 2 16 33 4 47.1 50.0 UCAUCGCUCGACUUGAU | - - - - - - - - 2 2 2 2 2 2 2 2 2 2 2 4\n"; |
---|
1532 | |
---|
1533 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1534 | hits_len_17 = count_hits(expected); |
---|
1535 | TEST_EXPECT_EQUAL(hits_len_17, 3); |
---|
1536 | } |
---|
1537 | // same as above with probelength 16 |
---|
1538 | int hits_len_16; |
---|
1539 | { |
---|
1540 | const char *arguments[] = { |
---|
1541 | "prgnamefake", |
---|
1542 | "designnames=ClnCorin#CltBotul#CPPParap#ClfPerfr", |
---|
1543 | "designmintargets=100", |
---|
1544 | "designprobelength=16", |
---|
1545 | }; |
---|
1546 | const char *expected = |
---|
1547 | "Probe design parameters:\n" |
---|
1548 | "Length of probe 16\n" |
---|
1549 | "Temperature [ 0.0 -400.0]\n" |
---|
1550 | "GC-content [30.0 - 80.0]\n" |
---|
1551 | "E.Coli position [any]\n" |
---|
1552 | "Max. nongroup hits 0\n" |
---|
1553 | "Min. group hits 100% (max. rejected coverage: 75%)\n" |
---|
1554 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1555 | "CGAAAGGAAGAUUAAU 16 A=94 82 77 4 31.2 42.0 AUUAAUCUUCCUUUCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1556 | "AAGGAAGAUUAAUACC 16 A+ 3 85 77 4 31.2 42.0 GGUAUUAAUCUUCCUU | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1557 | "AAGUCGAGCGAUGAAG 16 B=20 19 69 4 50.0 48.0 CUUCAUCGCUCGACUU | - - - - - - - - - - - - - - - - - 2 2 2\n" |
---|
1558 | "CAAGUCGAGCGAUGAA 16 B- 1 18 49 4 50.0 48.0 UUCAUCGCUCGACUUG | - - - - - - - - - - - - 2 2 2 2 2 2 2 2\n" |
---|
1559 | "UCAAGUCGAGCGAUGA 16 B- 2 17 37 4 50.0 48.0 UCAUCGCUCGACUUGA | - - - - - - - - - 2 2 2 2 2 2 2 2 2 2 2\n" |
---|
1560 | "AUCAAGUCGAGCGAUG 16 B- 3 16 21 4 50.0 48.0 CAUCGCUCGACUUGAU | - - - - - 2 2 2 2 2 2 2 2 2 2 2 2 9 9 9\n"; |
---|
1561 | |
---|
1562 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1563 | hits_len_16 = count_hits(expected); |
---|
1564 | TEST_EXPECT_EQUAL(hits_len_16, 6); |
---|
1565 | } |
---|
1566 | // combine the 3 preceeding designs |
---|
1567 | int combined_hits; |
---|
1568 | { |
---|
1569 | const char *arguments[] = { |
---|
1570 | "prgnamefake", |
---|
1571 | "designnames=ClnCorin#CltBotul#CPPParap#ClfPerfr", |
---|
1572 | "designmintargets=100", |
---|
1573 | "designprobelength=16", |
---|
1574 | "designmaxprobelength=18", |
---|
1575 | }; |
---|
1576 | const char *expected = |
---|
1577 | "Probe design parameters:\n" |
---|
1578 | "Length of probe 16-18\n" |
---|
1579 | "Temperature [ 0.0 -400.0]\n" |
---|
1580 | "GC-content [30.0 - 80.0]\n" |
---|
1581 | "E.Coli position [any]\n" |
---|
1582 | "Max. nongroup hits 0\n" |
---|
1583 | "Min. group hits 100% (max. rejected coverage: 75%)\n" |
---|
1584 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1585 | "CGAAAGGAAGAUUAAU 16 A=94 82 77 4 31.2 42.0 AUUAAUCUUCCUUUCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1586 | "CGAAAGGAAGAUUAAUAC 18 A+ 0 82 77 4 33.3 48.0 GUAUUAAUCUUCCUUUCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1587 | "GAAAGGAAGAUUAAUACC 18 A+ 1 83 77 4 33.3 48.0 GGUAUUAAUCUUCCUUUC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1588 | "AAGGAAGAUUAAUACC 16 A+ 3 85 77 4 31.2 42.0 GGUAUUAAUCUUCCUU | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1589 | "AAGUCGAGCGAUGAAG 16 B=20 19 69 4 50.0 48.0 CUUCAUCGCUCGACUU | - - - - - - - - - - - - - - - - - 2 2 2\n" |
---|
1590 | "CAAGUCGAGCGAUGAAG 17 B- 1 18 65 4 52.9 52.0 CUUCAUCGCUCGACUUG | - - - - - - - - - - - - - - - - 2 2 2 2\n" |
---|
1591 | "UCAAGUCGAGCGAUGAAG 18 B- 2 17 61 4 50.0 54.0 CUUCAUCGCUCGACUUGA | - - - - - - - - - - - - - - - 2 2 2 2 2\n" |
---|
1592 | "UCAAGUCGAGCGAUGAA 17 B- 2 17 49 4 47.1 50.0 UUCAUCGCUCGACUUGA | - - - - - - - - - - - - 2 2 2 2 2 2 2 2\n" |
---|
1593 | "CAAGUCGAGCGAUGAA 16 B- 1 18 49 4 50.0 48.0 UUCAUCGCUCGACUUG | - - - - - - - - - - - - 2 2 2 2 2 2 2 2\n" |
---|
1594 | "AUCAAGUCGAGCGAUGAA 18 B- 3 16 45 4 44.4 52.0 UUCAUCGCUCGACUUGAU | - - - - - - - - - - - 2 2 2 2 2 2 2 2 2\n" |
---|
1595 | "UCAAGUCGAGCGAUGA 16 B- 2 17 37 4 50.0 48.0 UCAUCGCUCGACUUGA | - - - - - - - - - 2 2 2 2 2 2 2 2 2 2 2\n" |
---|
1596 | "AUCAAGUCGAGCGAUGA 17 B- 3 16 33 4 47.1 50.0 UCAUCGCUCGACUUGAU | - - - - - - - - 2 2 2 2 2 2 2 2 2 2 2 4\n" |
---|
1597 | "AUCAAGUCGAGCGAUG 16 B- 3 16 21 4 50.0 48.0 CAUCGCUCGACUUGAU | - - - - - 2 2 2 2 2 2 2 2 2 2 2 2 9 9 9\n"; |
---|
1598 | |
---|
1599 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1600 | combined_hits = count_hits(expected); |
---|
1601 | } |
---|
1602 | |
---|
1603 | // check that combined design reports all probes reported by single designs: |
---|
1604 | TEST_EXPECT_EQUAL(combined_hits, hits_len_16+hits_len_17+hits_len_18); |
---|
1605 | } |
---|
1606 | // test vs bug (fails with [8988] .. [9175]) |
---|
1607 | { |
---|
1608 | const char *arguments[] = { |
---|
1609 | "prgnamefake", |
---|
1610 | "designnames=VbhChole#VblVulni", |
---|
1611 | "designmintargets=50", // hit at least 1 of the 2 targets |
---|
1612 | "designmingc=60", "designmaxgc=75", // specific GC range |
---|
1613 | }; |
---|
1614 | |
---|
1615 | const char *expected = |
---|
1616 | "Probe design parameters:\n" |
---|
1617 | "Length of probe 18\n" |
---|
1618 | "Temperature [ 0.0 -400.0]\n" |
---|
1619 | "GC-content [60.0 - 75.0]\n" |
---|
1620 | "E.Coli position [any]\n" |
---|
1621 | "Max. nongroup hits 0 (lowest rejected nongroup hits: 1)\n" |
---|
1622 | "Min. group hits 50%\n" |
---|
1623 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1624 | "AGUCGAGCGGCAGCACAG 18 A=21 20 39 2 66.7 60.0 CUGUGCUGCCGCUCGACU | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1625 | "GUCGAGCGGCAGCACAGA 18 A+ 1 21 39 2 66.7 60.0 UCUGUGCUGCCGCUCGAC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1626 | "UCGAGCGGCAGCACAGAG 18 A+ 2 21 39 2 66.7 60.0 CUCUGUGCUGCCGCUCGA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1627 | "AAGUCGAGCGGCAGCACA 18 A- 1 19 25 2 61.1 58.0 UGUGCUGCCGCUCGACUU | - - - - - - - - - - - - 1 1 1 1 1 1 1 1\n" |
---|
1628 | "CGAGCGGCAGCACAGAGA 18 A+ 3 21 20 1 66.7 60.0 UCUCUGUGCUGCCGCUCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1629 | "CGAGCGGCAGCACAGAGG 18 A+ 3 21 20 1 72.2 62.0 CCUCUGUGCUGCCGCUCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1630 | "GAGCGGCAGCACAGAGAA 18 A+ 4 21 20 1 61.1 58.0 UUCUCUGUGCUGCCGCUC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1631 | "GAGCGGCAGCACAGAGGA 18 A+ 4 21 20 1 66.7 60.0 UCCUCUGUGCUGCCGCUC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1632 | "AGCGGCAGCACAGAGGAA 18 A+ 5 21 20 1 61.1 58.0 UUCCUCUGUGCUGCCGCU | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1633 | "GCGGCAGCACAGAGAAAC 18 A+ 6 22 20 1 61.1 58.0 GUUUCUCUGUGCUGCCGC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1634 | "GCGGCAGCACAGAGGAAC 18 A+ 6 22 20 1 66.7 60.0 GUUCCUCUGUGCUGCCGC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1635 | "CGGCAGCACAGAGGAACU 18 A+ 7 23 20 1 61.1 58.0 AGUUCCUCUGUGCUGCCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1636 | "CUUGUUCCUUGGGUGGCG 18 B=52 47 20 1 61.1 58.0 CGCCACCCAAGGAACAAG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1637 | "CUUGUUUCUCGGGUGGCG 18 B+ 0 47 20 1 61.1 58.0 CGCCACCCGAGAAACAAG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1638 | "UGUUCCUUGGGUGGCGAG 18 B+ 2 49 20 1 61.1 58.0 CUCGCCACCCAAGGAACA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1639 | "UGUUUCUCGGGUGGCGAG 18 B+ 2 49 20 1 61.1 58.0 CUCGCCACCCGAGAAACA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1640 | "GUUCCUUGGGUGGCGAGC 18 B+ 3 50 20 1 66.7 60.0 GCUCGCCACCCAAGGAAC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1641 | "GUUUCUCGGGUGGCGAGC 18 B+ 3 50 20 1 66.7 60.0 GCUCGCCACCCGAGAAAC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1642 | "UUCCUUGGGUGGCGAGCG 18 B+10 57 20 1 66.7 60.0 CGCUCGCCACCCAAGGAA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1643 | "UUUCUCGGGUGGCGAGCG 18 B+10 57 20 1 66.7 60.0 CGCUCGCCACCCGAGAAA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1644 | "UCCUUGGGUGGCGAGCGG 18 B+11 58 20 1 72.2 62.0 CCGCUCGCCACCCAAGGA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1645 | "UUCUCGGGUGGCGAGCGG 18 B+11 58 20 1 72.2 62.0 CCGCUCGCCACCCGAGAA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1646 | "CAAGUCGAGCGGCAGCAC 18 A- 2 18 13 2 66.7 60.0 GUGCUGCCGCUCGACUUG | - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1647 | "UCAAGUCGAGCGGCAGCA 18 A- 3 17 3 2 61.1 58.0 UGCUGCCGCUCGACUUGA | - 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 3 3\n"; |
---|
1648 | |
---|
1649 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1650 | } |
---|
1651 | |
---|
1652 | // design MANY probes to test location specifier |
---|
1653 | { |
---|
1654 | const char *arguments_loc[] = { |
---|
1655 | "prgnamefake", |
---|
1656 | // "designnames=Stsssola#Stsssola", // @@@ crashes the ptserver |
---|
1657 | "designnames=CPPParap#PsAAAA00", |
---|
1658 | "designmintargets=50", // hit at least 1 of the 2 targets |
---|
1659 | "designmingc=0", "designmaxgc=100", // allow all GCs |
---|
1660 | "designmintemp=30", "designmaxtemp=100", // allow all temp above 30 deg |
---|
1661 | "designmishit=7", // allow enough outgroup hits |
---|
1662 | "designprobelength=9", |
---|
1663 | }; |
---|
1664 | |
---|
1665 | const char *expected_loc = |
---|
1666 | "A=29B=51B+1C=99A+8D=112E=80E+2E+3E+4B-1A-5B-6B-5F=124F+1B-2E-7B+0C-5E+2E-1D-1E+6E+7E+8G=89C-2A-1H=61A-6C-1C-3E+3B+3B+4B+5E+5C+1E+4E+6E+7E+8C-7C-6E+5H+1H+2E-6C-4I=152I+1A-7"; |
---|
1667 | |
---|
1668 | TEST_ARB_PROBE_FILT(ARRAY_ELEMS(arguments_loc), arguments_loc, extract_locations, expected_loc); |
---|
1669 | } |
---|
1670 | |
---|
1671 | // same as above |
---|
1672 | { |
---|
1673 | const char *arguments[] = { |
---|
1674 | "prgnamefake", |
---|
1675 | "designnames=CPPParap#PsAAAA00", |
---|
1676 | "designmintargets=50", // hit at least 1 of the 2 targets |
---|
1677 | "designmingc=0", "designmaxgc=100", // allow all GCs |
---|
1678 | "designmintemp=30", "designmaxtemp=100", // allow all temp above 30 deg |
---|
1679 | "designmishit=7", // allow enough outgroup hits |
---|
1680 | "designprobelength=9", |
---|
1681 | }; |
---|
1682 | |
---|
1683 | const char *expected = |
---|
1684 | "Probe design parameters:\n" |
---|
1685 | "Length of probe 9\n" |
---|
1686 | "Temperature [30.0 -100.0]\n" |
---|
1687 | "GC-content [ 0.0 -100.0]\n" |
---|
1688 | "E.Coli position [any]\n" |
---|
1689 | "Max. nongroup hits 7 (lowest rejected nongroup hits: 9)\n" |
---|
1690 | "Min. group hits 50%\n" |
---|
1691 | "Target le apos ecol qual grps G+C temp Probe | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1692 | "GAGCGGAUG 9 A= 29 24 20 1 66.7 30.0 CAUCCGCUC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1693 | "UGCUCCUGG 9 B= 51 46 20 1 66.7 30.0 CCAGGAGCA | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1694 | "GCUCCUGGA 9 B+ 1 47 20 1 66.7 30.0 UCCAGGAGC | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1695 | "CGGGCGCUA 9 C= 99 87 20 1 77.8 32.0 UAGCGCCCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1696 | "GAAGGGAGC 9 A+ 8 32 20 1 66.7 30.0 GCUCCCUUC | 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2\n" |
---|
1697 | "CGCAUACGC 9 D=112 100 20 1 66.7 30.0 GCGUAUGCG | 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2\n" |
---|
1698 | "CGGACGGGC 9 E= 80 69 20 1 88.9 34.0 GCCCGUCCG | 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3\n" |
---|
1699 | "GGACGGGCC 9 E+ 2 70 20 1 88.9 34.0 GGCCCGUCC | 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1700 | "GACGGGCCU 9 E+ 3 71 20 1 77.8 32.0 AGGCCCGUC | 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1701 | "ACGGGCCUU 9 E+ 4 72 20 1 66.7 30.0 AAGGCCCGU | 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1702 | "UCCUUCGGG 9 B- 1 45 20 1 66.7 30.0 CCCGAAGGA | 2 2 2 2 2 2 2 2 2 2 2 2 3 4 4 4 4 4 4 4\n" |
---|
1703 | "CGAGCGAUG 9 A- 5 21 20 1 66.7 30.0 CAUCGCUCG | 3 3 3 3 3 3 3 3 3 3 5 5 5 5 5 5 5 5 5 5\n" |
---|
1704 | "GGGAGCUUG 9 B- 6 40 20 1 66.7 30.0 CAAGCUCCC | 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 5\n" |
---|
1705 | "GGAGCUUGC 9 B- 5 41 20 1 66.7 30.0 GCAAGCUCC | 4 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5\n" |
---|
1706 | "GCGAUUGGG 9 F=124 111 20 1 66.7 30.0 CCCAAUCGC | 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 6 6\n" |
---|
1707 | "CGAUUGGGG 9 F+ 1 112 20 1 66.7 30.0 CCCCAAUCG | 3 3 3 3 3 3 6 6 6 6 6 6 6 6 6 6 6 6 6 6\n" |
---|
1708 | "GCUUGCUCC 9 B- 2 44 20 1 66.7 30.0 GGAGCAAGC | 4 4 4 4 4 4 5 5 5 5 5 5 5 7 7 7 7 8 8 8\n" |
---|
1709 | "UUAGCGGCG 9 E- 7 62 19 1 66.7 30.0 CGCCGCUAA | 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 6 6 6 11 11\n" |
---|
1710 | "CCUUCGGGA 9 B+ 0 46 18 1 66.7 30.0 UCCCGAAGG | 2 2 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 5 5 13\n" |
---|
1711 | "GGAAACGGG 9 C- 5 82 17 1 66.7 30.0 CCCGUUUCC | - - - - - - - - - - - - - - - - 3 3 3 3\n" |
---|
1712 | "GGACGGACG 9 E+ 2 70 17 1 77.8 32.0 CGUCCGUCC | 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 10 10 14 14\n" |
---|
1713 | "GCGGACGGG 9 E- 1 68 17 1 88.9 34.0 CCCGUCCGC | 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 13 13 13 13\n" |
---|
1714 | "CCGCAUACG 9 D- 1 99 16 1 66.7 30.0 CGUAUGCGG | 2 2 2 2 2 2 2 2 2 2 2 4 4 4 4 5 5 5 5 5\n" |
---|
1715 | "GGACGUCCG 9 E+ 6 74 14 1 77.8 32.0 CGGACGUCC | - - - - - - - - - - - - - 1 1 1 1 3 3 3\n" |
---|
1716 | "GACGUCCGG 9 E+ 7 75 14 1 77.8 32.0 CCGGACGUC | - - - - - - - - - - - - - 1 1 1 1 2 2 14\n" |
---|
1717 | "ACGUCCGGA 9 E+ 8 76 14 1 66.7 30.0 UCCGGACGU | - - - - - - - - - - - - - 1 1 11 11 12 12 17\n" |
---|
1718 | "CGUCCGGAA 9 G= 89 77 14 1 66.7 30.0 UUCCGGACG | - - - - - - - - - - - - - 1 1 1 1 2 2 2\n" |
---|
1719 | "AACGGGCGC 9 C- 2 85 14 1 77.8 32.0 GCGCCCGUU | - - - - - - - - - - - - - 1 1 1 1 1 1 2\n" |
---|
1720 | "CGAGCGGAU 9 A- 1 23 13 1 66.7 30.0 AUCCGCUCG | - - - - - - - - - - - - 3 3 3 3 3 3 3 3\n" |
---|
1721 | "UUCAGCGGC 9 H= 61 56 13 1 66.7 30.0 GCCGCUGAA | 1 1 1 1 1 1 2 2 2 2 2 2 3 4 4 4 4 4 7 7\n" |
---|
1722 | "UCGAGCGGA 9 A- 6 21 13 1 66.7 30.0 UCCGCUCGA | 3 3 3 3 3 3 3 3 3 3 3 3 8 8 8 8 8 8 8 8\n" |
---|
1723 | "ACGGGCGCU 9 C- 1 86 12 1 77.8 32.0 AGCGCCCGU | - - - - - - - - - - - 1 1 1 1 1 1 2 2 2\n" |
---|
1724 | "AAACGGGCG 9 C- 3 84 9 1 66.7 30.0 CGCCCGUUU | - - - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1725 | "GACGGACGU 9 E+ 3 71 9 1 66.7 30.0 ACGUCCGUC | 2 2 2 2 2 2 2 2 13 13 13 13 13 13 13 14 14 14 14 14\n" |
---|
1726 | "UCGGGAACG 9 B+ 3 49 7 1 66.7 30.0 CGUUCCCGA | - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1727 | "CGGGAACGG 9 B+ 4 50 7 1 77.8 32.0 CCGUUCCCG | - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1728 | "GGGAACGGA 9 B+ 5 51 7 1 66.7 30.0 UCCGUUCCC | - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1729 | "CGGACGUCC 9 E+ 5 73 7 1 77.8 32.0 GGACGUCCG | - - - - - - 1 1 1 1 1 1 1 3 3 3 3 12 12 12\n" |
---|
1730 | "GGGCGCUAA 9 C+ 1 88 7 1 66.7 30.0 UUAGCGCCC | - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1731 | "ACGGACGUC 9 E+ 4 72 7 1 66.7 30.0 GACGUCCGU | - - - - - - 2 2 3 3 3 4 4 4 4 5 5 5 5 13\n" |
---|
1732 | "GGGCCUUCC 9 E+ 6 74 7 1 77.8 32.0 GGAAGGCCC | - - - - - - 2 2 2 2 2 3 3 3 3 3 3 3 3 4\n" |
---|
1733 | "GGCCUUCCG 9 E+ 7 75 7 1 77.8 32.0 CGGAAGGCC | - - - - - - 2 2 2 2 2 3 3 3 3 3 3 3 3 3\n" |
---|
1734 | "GCCUUCCGA 9 E+ 8 76 7 1 66.7 30.0 UCGGAAGGC | - - - - - - 2 2 2 2 2 3 3 3 3 3 3 3 3 3\n" |
---|
1735 | "CCGGAAACG 9 C- 7 80 7 1 66.7 30.0 CGUUUCCGG | - - - - - - 2 2 2 2 2 2 2 6 7 9 9 10 10 10\n" |
---|
1736 | "CGGAAACGG 9 C- 6 81 7 1 66.7 30.0 CCGUUUCCG | - - - - - - 2 2 4 4 4 4 4 4 5 5 6 6 6 6\n" |
---|
1737 | "CGGGCCUUC 9 E+ 5 73 7 1 77.8 32.0 GAAGGCCCG | 1 1 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1738 | "UCAGCGGCG 9 H+ 1 57 7 1 77.8 32.0 CGCCGCUGA | 2 2 2 2 2 2 6 6 6 6 6 6 6 6 6 6 7 7 7 7\n" |
---|
1739 | "CAGCGGCGG 9 H+ 2 58 7 1 88.9 34.0 CCGCCGCUG | 2 2 2 2 2 2 6 6 6 6 6 6 6 7 12 12 12 12 12 12\n" |
---|
1740 | "UAGCGGCGG 9 E- 6 63 7 1 77.8 32.0 CCGCCGCUA | 4 4 4 4 4 4 10 10 10 10 10 10 12 14 14 14 14 14 14 14\n" |
---|
1741 | "GAAACGGGC 9 C- 4 83 5 1 66.7 30.0 GCCCGUUUC | - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1742 | "GCCGUAGGA 9 I=152 138 3 1 66.7 30.0 UCCUACGGC | 1 1 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 9 12 12\n" |
---|
1743 | "CCGUAGGAG 9 I+ 1 139 3 1 66.7 30.0 CUCCUACGG | 1 1 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 11 11\n" |
---|
1744 | "GUCGAGCGA 9 A- 7 21 3 1 66.7 30.0 UCGCUCGAC | 3 3 11 11 11 11 11 11 11 11 11 11 11 11 11 12 12 12 12 14\n"; |
---|
1745 | |
---|
1746 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1747 | } |
---|
1748 | |
---|
1749 | #if defined(ARB_64) |
---|
1750 | #define RES_64 |
---|
1751 | #else // !defined(ARB_64) |
---|
1752 | // results below differ for some(!) 32 bit arb versions (numeric issues?) |
---|
1753 | // (e.g. u1004 behaves like 64bit version; u1204 doesnt) |
---|
1754 | // #define RES_64 // uncomment for u1004 |
---|
1755 | #endif |
---|
1756 | |
---|
1757 | |
---|
1758 | // same as above (with probelen == 8) |
---|
1759 | { |
---|
1760 | const char *arguments[] = { |
---|
1761 | "prgnamefake", |
---|
1762 | "designnames=CPPParap#PsAAAA00", |
---|
1763 | "designmintargets=50", // hit at least 1 of the 2 targets |
---|
1764 | "designmingc=0", "designmaxgc=100", // allow all GCs |
---|
1765 | "designmintemp=30", "designmaxtemp=100", // allow all temp above 30 deg |
---|
1766 | // "designmishit=7", |
---|
1767 | "designmishit=15", // @@@ reports more results than with 7 mishits, but no mishits reported below! |
---|
1768 | "designprobelength=8", |
---|
1769 | }; |
---|
1770 | |
---|
1771 | const char *expected = |
---|
1772 | "Probe design parameters:\n" |
---|
1773 | "Length of probe 8\n" |
---|
1774 | "Temperature [30.0 -100.0]\n" |
---|
1775 | "GC-content [ 0.0 -100.0]\n" |
---|
1776 | "E.Coli position [any]\n" |
---|
1777 | "Max. nongroup hits 15\n" |
---|
1778 | "Min. group hits 50%\n" |
---|
1779 | "Target le apos ecol qual grps G+C temp Probe | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1780 | "GGCGGACG 8 A=78 67 39 2 87.5 30.0 CGUCCGCC | 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13\n" |
---|
1781 | "GCGGACGG 8 A+ 1 68 39 2 87.5 30.0 CCGUCCGC | 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13\n" |
---|
1782 | "AGCGGCGG 8 A- 3 64 39 2 87.5 30.0 CCGCCGCU | 11 11 11 11 11 11 11 14 14 14 14 14 14 14 14 14 14 14 14 14\n" |
---|
1783 | "GCGGCGGA 8 A- 2 65 39 2 87.5 30.0 UCCGCCGC | 10 10 11 11 11 11 11 14 14 14 14 14 14 14 14 14 14 14 14 14\n" |
---|
1784 | "CGGCGGAC 8 A- 1 66 39 2 87.5 30.0 GUCCGCCG | 10 10 10 10 10 10 10 13 13 13 13 13 13 13 14 14 14 14 14 14\n" |
---|
1785 | "CGGACGGG 8 A+ 2 69 20 1 87.5 30.0 CCCGUCCG | 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2\n" |
---|
1786 | "GGACGGGC 8 A+ 4 70 20 1 87.5 30.0 GCCCGUCC | 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1787 | "GACGGGCC 8 A+ 5 71 20 1 87.5 30.0 GGCCCGUC | 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1788 | #if defined(RES_64) |
---|
1789 | "ACGGGCGC 8 B=98 86 13 1 87.5 30.0 GCGCCCGU | - - - - - - - - - - - - 1 1 1 1 1 1 1 1\n" |
---|
1790 | "CGGGCGCU 8 B+ 1 87 13 1 87.5 30.0 AGCGCCCG | - - - - - - - - - - - - 1 1 1 1 1 1 1 1\n" |
---|
1791 | "CAGCGGCG 8 C=63 58 8 1 87.5 30.0 CGCCGCUG | 2 2 2 2 2 2 2 6 6 6 6 6 6 6 8 8 8 8 8 8\n"; |
---|
1792 | #else // !defined(RES_64) |
---|
1793 | "ACGGGCGC 8 B=98 86 13 1 87.5 30.0 GCGCCCGU | - - - - - - - - - - - - 1 1 1 1 1 1 1 2\n" |
---|
1794 | "CGGGCGCU 8 B+ 1 87 13 1 87.5 30.0 AGCGCCCG | - - - - - - - - - - - - 1 1 1 1 1 1 1 2\n" |
---|
1795 | "CAGCGGCG 8 C=63 58 8 1 87.5 30.0 CGCCGCUG | 2 2 2 2 2 2 2 6 6 6 6 6 6 6 8 8 8 8 8 10\n"; |
---|
1796 | #endif |
---|
1797 | |
---|
1798 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1799 | } |
---|
1800 | |
---|
1801 | // same as above (but restricting ecoli-range) |
---|
1802 | { |
---|
1803 | const char *arguments[] = { |
---|
1804 | "prgnamefake", |
---|
1805 | "designnames=CPPParap#PsAAAA00", |
---|
1806 | "designmintargets=50", // hit at least 1 of the 2 targets |
---|
1807 | "designmingc=0", "designmaxgc=100", // allow all GCs |
---|
1808 | "designmintemp=30", "designmaxtemp=100", // allow all temp above 30 deg |
---|
1809 | "designmishit=15", |
---|
1810 | "designprobelength=8", |
---|
1811 | "designminpos=65", "designmaxpos=69", // restrict ecoli-range |
---|
1812 | }; |
---|
1813 | |
---|
1814 | const char *expected = |
---|
1815 | "Probe design parameters:\n" |
---|
1816 | "Length of probe 8\n" |
---|
1817 | "Temperature [30.0 -100.0]\n" |
---|
1818 | "GC-content [ 0.0 -100.0]\n" |
---|
1819 | "E.Coli position [ 65 - 69]\n" |
---|
1820 | "Max. nongroup hits 15\n" |
---|
1821 | "Min. group hits 50%\n" |
---|
1822 | "Target le apos ecol qual grps G+C temp Probe | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1823 | "GGCGGACG 8 A=78 67 39 2 87.5 30.0 CGUCCGCC | 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13\n" |
---|
1824 | "GCGGACGG 8 A+ 1 68 39 2 87.5 30.0 CCGUCCGC | 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13\n" |
---|
1825 | "GCGGCGGA 8 A- 2 65 39 2 87.5 30.0 UCCGCCGC | 10 10 11 11 11 11 11 14 14 14 14 14 14 14 14 14 14 14 14 14\n" |
---|
1826 | "CGGCGGAC 8 A- 1 66 39 2 87.5 30.0 GUCCGCCG | 10 10 10 10 10 10 10 13 13 13 13 13 13 13 14 14 14 14 14 14\n" |
---|
1827 | "CGGACGGG 8 A+ 2 69 20 1 87.5 30.0 CCCGUCCG | 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2\n"; |
---|
1828 | |
---|
1829 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1830 | } |
---|
1831 | |
---|
1832 | { |
---|
1833 | const char *arguments[] = { |
---|
1834 | "prgnamefake", |
---|
1835 | "designnames=ClnCorin#CPPParap#ClfPerfr", |
---|
1836 | "designprobelength=16", |
---|
1837 | "designmintargets=100", |
---|
1838 | "designmishit=2", |
---|
1839 | }; |
---|
1840 | const char *expected = |
---|
1841 | "Probe design parameters:\n" |
---|
1842 | "Length of probe 16\n" |
---|
1843 | "Temperature [ 0.0 -400.0]\n" |
---|
1844 | "GC-content [30.0 - 80.0]\n" |
---|
1845 | "E.Coli position [any]\n" |
---|
1846 | "Max. nongroup hits 2 (lowest rejected nongroup hits: 6)\n" |
---|
1847 | "Min. group hits 100% (max. rejected coverage: 67%)\n" |
---|
1848 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1849 | "CGAAAGGAAGAUUAAU 16 A=94 82 58 3 31.2 42.0 AUUAAUCUUCCUUUCG | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1850 | "AAGGAAGAUUAAUACC 16 A+ 3 85 58 3 31.2 42.0 GGUAUUAAUCUUCCUU | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1851 | "AAGUCGAGCGAUGAAG 16 B=20 19 52 3 50.0 48.0 CUUCAUCGCUCGACUU | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 3 3\n" |
---|
1852 | "CAAGUCGAGCGAUGAA 16 B- 1 18 37 3 50.0 48.0 UUCAUCGCUCGACUUG | 1 1 1 1 1 1 1 1 1 1 1 1 3 3 3 3 3 3 3 3\n" |
---|
1853 | "GUCGAGCGAUGAAGUU 16 B+ 2 21 31 3 50.0 48.0 AACUUCAUCGCUCGAC | - - - - - - - - - - 1 1 1 1 1 1 1 1 1 1\n" |
---|
1854 | "UCAAGUCGAGCGAUGA 16 B- 2 17 28 3 50.0 48.0 UCAUCGCUCGACUUGA | 1 1 1 1 1 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1855 | "AGUCGAGCGAUGAAGU 16 B+ 1 20 19 3 50.0 48.0 ACUUCAUCGCUCGACU | - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1856 | "AUCAAGUCGAGCGAUG 16 B- 3 16 16 3 50.0 48.0 CAUCGCUCGACUUGAU | 1 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3 3 10 10 10\n" |
---|
1857 | "GAUCAAGUCGAGCGAU 16 B- 4 15 4 3 50.0 48.0 AUCGCUCGACUUGAUC | - 2 2 2 3 3 3 3 10 10 10 10 10 10 10 10 10 10 10 10\n" |
---|
1858 | "UGAUCAAGUCGAGCGA 16 B- 5 14 4 3 50.0 48.0 UCGCUCGACUUGAUCA | - 9 9 9 9 9 9 9 10 10 10 10 10 10 10 10 10 10 10 10\n"; |
---|
1859 | |
---|
1860 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1861 | } |
---|
1862 | // test same design as above, but add 2 "unknown species" each of which is missing one of the previously designed probes |
---|
1863 | { |
---|
1864 | const char *arguments[] = { |
---|
1865 | "prgnamefake", |
---|
1866 | "designnames=ClnCorin#Unknown1#CPPParap#ClfPerfr#Unknown2", |
---|
1867 | "designprobelength=16", |
---|
1868 | "designmintargets=100", |
---|
1869 | "designmishit=2", |
---|
1870 | // pass sequences for the unknown species |
---|
1871 | "designsequence=---CGAAAGGAAGAUUAAU------------------AAGUCGAGCGAUGAAG-CAAGUCGAGCGAUGAA-GUCGAGCGAUGAAGUU-UCAAGUCGAGCGAUGA-AGUCGAGCGAUGAAGU-AUCAAGUCGAGCGAUG-GAUCAAGUCGAGCGAU-UGAUCAAGUCGAGCGA", |
---|
1872 | "designsequence=---CGAAAGGAAGAUUAAU-AAGGAAGAUUAAUACC-AAGUCGAGCGAUGAAG-CAAGUCGAGCGAUGAA-GUCGAGCGAUGAAGUU-UCAAGUCGAGCGAUGA-AGUCGAGCGAUGAAGU-AUCAAGUCGAGCGAUG------------------UGAUCAAGUCGAGCGA", |
---|
1873 | }; |
---|
1874 | const char *expected = |
---|
1875 | "Probe design parameters:\n" |
---|
1876 | "Length of probe 16\n" |
---|
1877 | "Temperature [ 0.0 -400.0]\n" |
---|
1878 | "GC-content [30.0 - 80.0]\n" |
---|
1879 | "E.Coli position [any]\n" |
---|
1880 | "Max. nongroup hits 2\n" |
---|
1881 | "Min. group hits 100% (max. rejected coverage: 80%)\n" |
---|
1882 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1883 | "CGAAAGGAAGAUUAAU 16 A=94 82 96 5 31.2 42.0 AUUAAUCUUCCUUUCG | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1884 | // AAGGAAGAUUAAUACC is not designed here |
---|
1885 | "AAGUCGAGCGAUGAAG 16 B=20 19 86 5 50.0 48.0 CUUCAUCGCUCGACUU | 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 3 3\n" |
---|
1886 | "CAAGUCGAGCGAUGAA 16 B- 1 18 61 5 50.0 48.0 UUCAUCGCUCGACUUG | 1 1 1 1 1 1 1 1 1 1 1 1 3 3 3 3 3 3 3 3\n" |
---|
1887 | "GUCGAGCGAUGAAGUU 16 B+ 2 21 51 5 50.0 48.0 AACUUCAUCGCUCGAC | - - - - - - - - - - 1 1 1 1 1 1 1 1 1 1\n" |
---|
1888 | "UCAAGUCGAGCGAUGA 16 B- 2 17 46 5 50.0 48.0 UCAUCGCUCGACUUGA | 1 1 1 1 1 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1889 | "AGUCGAGCGAUGAAGU 16 B+ 1 20 31 5 50.0 48.0 ACUUCAUCGCUCGACU | - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1890 | "AUCAAGUCGAGCGAUG 16 B- 3 16 26 5 50.0 48.0 CAUCGCUCGACUUGAU | 1 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3 3 10 10 10\n" |
---|
1891 | // GAUCAAGUCGAGCGAU is not designed here |
---|
1892 | "UGAUCAAGUCGAGCGA 16 B- 5 14 6 5 50.0 48.0 UCGCUCGACUUGAUCA | - 9 9 9 9 9 9 9 10 10 10 10 10 10 10 10 10 10 10 10\n"; |
---|
1893 | |
---|
1894 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1895 | } |
---|
1896 | { |
---|
1897 | const char *arguments[] = { |
---|
1898 | "prgnamefake", |
---|
1899 | "designnames=VbrFurni", |
---|
1900 | "designprobelength=8", |
---|
1901 | "designmingc=80", |
---|
1902 | "designmaxgc=100", |
---|
1903 | }; |
---|
1904 | const char *expected = |
---|
1905 | "Probe design parameters:\n" |
---|
1906 | "Length of probe 8\n" |
---|
1907 | "Temperature [ 0.0 -400.0]\n" |
---|
1908 | "GC-content [80.0 -100.0]\n" |
---|
1909 | "E.Coli position [any]\n" |
---|
1910 | "Max. nongroup hits 0 (lowest rejected nongroup hits: 2)\n" |
---|
1911 | "Min. group hits 50%\n" |
---|
1912 | "Target le apos ecol qual grps G+C temp Probe | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1913 | #if defined(RES_64) |
---|
1914 | "CGGCAGCG 8 A=28 23 20 1 87.5 30.0 CGCUGCCG | - - - - - - - - - - - - - - - - - - - -\n" |
---|
1915 | #else // !defined(RES_64) |
---|
1916 | "CGGCAGCG 8 A=28 23 20 1 87.5 30.0 CGCUGCCG | - - - - - - - - - - - - - - - - - - - 3\n" |
---|
1917 | #endif |
---|
1918 | "UGGGCGGC 8 B=67 60 8 1 87.5 30.0 GCCGCCCA | - - - - - - - 1 1 1 1 1 1 1 1 1 1 1 1 1\n" |
---|
1919 | #if defined(RES_64) |
---|
1920 | "CGGCGAGC 8 B+ 4 60 8 1 87.5 30.0 GCUCGCCG | - - - - - - - 2 2 2 2 2 2 2 4 4 4 4 4 4\n" |
---|
1921 | #else // !defined(RES_64) |
---|
1922 | "CGGCGAGC 8 B+ 4 60 8 1 87.5 30.0 GCUCGCCG | - - - - - - - 2 2 2 2 2 2 2 4 4 4 4 4 5\n" |
---|
1923 | #endif |
---|
1924 | "GGGCGGCG 8 B+ 1 60 8 1 100.0 32.0 CGCCGCCC | - - - - - - - 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1925 | "GGCGGCGA 8 B+ 2 60 8 1 87.5 30.0 UCGCCGCC | - - - - - - - 3 3 3 3 3 3 3 3 3 3 3 3 3\n" |
---|
1926 | "GCGGCGAG 8 B+ 3 60 3 1 87.5 30.0 CUCGCCGC | - - 1 1 1 1 1 4 4 4 4 4 4 4 4 4 4 4 4 4\n"; |
---|
1927 | |
---|
1928 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1929 | } |
---|
1930 | { |
---|
1931 | const char *arguments[] = { |
---|
1932 | "prgnamefake", |
---|
1933 | "designnames=HllHalod#VbhChole#VblVulni#VbrFurni#PtVVVulg", |
---|
1934 | "designprobelength=14", |
---|
1935 | "designmintargets=100", |
---|
1936 | "designmishit=4", |
---|
1937 | "designmingc=70", |
---|
1938 | "designmaxgc=100", |
---|
1939 | }; |
---|
1940 | const char *expected = |
---|
1941 | "Probe design parameters:\n" |
---|
1942 | "Length of probe 14\n" |
---|
1943 | "Temperature [ 0.0 -400.0]\n" |
---|
1944 | "GC-content [70.0 -100.0]\n" |
---|
1945 | "E.Coli position [any]\n" |
---|
1946 | "Max. nongroup hits 4\n" |
---|
1947 | "Min. group hits 100% (max. rejected coverage: 80%)\n" |
---|
1948 | "Target le apos ecol qual grps G+C temp Probe sequence | Decrease T by n*.3C -> probe matches n non group species\n" |
---|
1949 | "GAGCGGCGGACGGA 14 A=75 64 21 5 78.6 50.0 UCCGUCCGCCGCUC | - - - - 1 1 1 1 1 1 5 5 9 9 10 10 10 10 10 10\n" |
---|
1950 | "CGAGCGGCGGACGG 14 A- 1 63 21 5 85.7 52.0 CCGUCCGCCGCUCG | - - - - 2 2 2 2 2 2 2 2 2 2 2 2 2 2 9 9\n" |
---|
1951 | "AGCGGCGGACGGAC 14 A+ 0 64 21 5 78.6 50.0 GUCCGUCCGCCGCU | 4 7 7 7 9 9 9 9 9 9 9 9 9 9 9 9 9 10 10 10\n"; |
---|
1952 | |
---|
1953 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1954 | } |
---|
1955 | { |
---|
1956 | const char *arguments[] = { |
---|
1957 | "prgnamefake", |
---|
1958 | "designnames=HllHalod#VbhChole#VblVulni#VbrFurni#PtVVVulg", |
---|
1959 | "designprobelength=14", |
---|
1960 | "designmintargets=100", |
---|
1961 | "designmishit=0", |
---|
1962 | "designmingc=51", |
---|
1963 | "designmaxgc=60", |
---|
1964 | }; |
---|
1965 | const char *expected = ""; // no probes found! |
---|
1966 | |
---|
1967 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
1968 | } |
---|
1969 | |
---|
1970 | } |
---|
1971 | |
---|
1972 | void TEST_SLOW_probe_design_errors() { |
---|
1973 | // test here runs versus database ../UNIT_TESTER/run/TEST_pt_src.arb |
---|
1974 | |
---|
1975 | bool use_gene_ptserver = false; |
---|
1976 | { |
---|
1977 | const char *arguments[] = { |
---|
1978 | "prgnamefake", |
---|
1979 | "designnames=CPPParap#PsAAAA00", |
---|
1980 | "designprobelength=3", |
---|
1981 | }; |
---|
1982 | const char *expected_error = "Specified min. probe length 3 is below the min. allowed probe length of 8"; |
---|
1983 | |
---|
1984 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
1985 | } |
---|
1986 | { |
---|
1987 | const char *arguments[] = { |
---|
1988 | "prgnamefake", |
---|
1989 | "designnames=CPPParap#PsAAAA00", |
---|
1990 | "designprobelength=15", |
---|
1991 | "designmaxprobelength=12", |
---|
1992 | }; |
---|
1993 | const char *expected_error = "Max. probe length 12 is below the specified min. probe length of 15"; |
---|
1994 | |
---|
1995 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
1996 | } |
---|
1997 | { |
---|
1998 | const char *expected_error = "Sequence contains only 0 bp. Impossible design request for one of the added sequences"; |
---|
1999 | { |
---|
2000 | const char *arguments[] = { |
---|
2001 | "prgnamefake", |
---|
2002 | "designsequence=", // pass an empty sequence |
---|
2003 | "designprobelength=16", |
---|
2004 | }; |
---|
2005 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
2006 | } |
---|
2007 | { |
---|
2008 | const char *arguments[] = { |
---|
2009 | "prgnamefake", |
---|
2010 | "designsequence=-------------", // pass a gap-only sequence |
---|
2011 | "designprobelength=16", |
---|
2012 | }; |
---|
2013 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
2014 | } |
---|
2015 | } |
---|
2016 | { |
---|
2017 | const char *arguments[] = { |
---|
2018 | "prgnamefake", |
---|
2019 | "designsequence=ACGTACGTACGTACGT", // pass a long enough (unexpected) sequence |
---|
2020 | "designprobelength=16", |
---|
2021 | }; |
---|
2022 | const char *expected_error = "Got 0 unknown marked species, but 1 custom sequence was added (has to match)"; |
---|
2023 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
2024 | } |
---|
2025 | { |
---|
2026 | const char *arguments[] = { |
---|
2027 | "prgnamefake", |
---|
2028 | "designnames=Unknown", // one unknown species |
---|
2029 | "designprobelength=16", |
---|
2030 | }; |
---|
2031 | const char *expected_error = "No species marked - no probes designed"; |
---|
2032 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
2033 | } |
---|
2034 | { |
---|
2035 | const char *arguments[] = { |
---|
2036 | "prgnamefake", |
---|
2037 | "designnames=Unknown#CPPParap", // one unknown species, one known species |
---|
2038 | "designprobelength=16", |
---|
2039 | }; |
---|
2040 | const char *expected_error = "Got 1 unknown marked species, but 0 custom sequences were added (has to match)"; |
---|
2041 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
2042 | } |
---|
2043 | { |
---|
2044 | const char *expected_error = "Sequence contains only 0 bp. Impossible design request for one of the added sequences"; |
---|
2045 | { |
---|
2046 | const char *arguments[] = { |
---|
2047 | "prgnamefake", |
---|
2048 | "designnames=Unknown", // one unknown species |
---|
2049 | "designsequence=", // pass an empty sequence |
---|
2050 | "designprobelength=16", |
---|
2051 | }; |
---|
2052 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
2053 | } |
---|
2054 | { |
---|
2055 | const char *arguments[] = { |
---|
2056 | "prgnamefake", |
---|
2057 | "designnames=Unknown", // one unknown species |
---|
2058 | "designsequence=-------------", // pass a gap-only sequence |
---|
2059 | "designprobelength=16", |
---|
2060 | }; |
---|
2061 | TEST_ARB_PROBE__REPORTS_ERROR(ARRAY_ELEMS(arguments), arguments, expected_error); |
---|
2062 | } |
---|
2063 | } |
---|
2064 | } |
---|
2065 | |
---|
2066 | void TEST_SLOW_match_designed_probe() { |
---|
2067 | // test here runs versus database ../UNIT_TESTER/run/TEST_pt_src.arb |
---|
2068 | |
---|
2069 | bool use_gene_ptserver = false; |
---|
2070 | const char *arguments[] = { |
---|
2071 | "prgnamefake", |
---|
2072 | "matchsequence=UCAAGUCGAGCGAUGAAG", |
---|
2073 | }; |
---|
2074 | CCP expected = " name---- fullname mis N_mis wmis pos ecoli rev 'UCAAGUCGAGCGAUGAAG'\1" |
---|
2075 | "ClnCorin\1" " ClnCorin 0 0 0.0 18 17 0 .GAGUUUGA-==================-UUCCUUCGG\1" |
---|
2076 | "CltBotul\1" " CltBotul 0 0 0.0 18 17 0 ........A-==================-CUUCUUCGG\1" |
---|
2077 | "CPPParap\1" " CPPParap 0 0 0.0 18 17 0 AGAGUUUGA-==================-UUCCUUCGG\1" |
---|
2078 | "ClfPerfr\1" " ClfPerfr 0 0 0.0 18 17 0 AGAGUUUGA-==================-UUUCCUUCG\1"; |
---|
2079 | |
---|
2080 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
2081 | } |
---|
2082 | |
---|
2083 | void TEST_SLOW_get_existing_probes() { |
---|
2084 | // test here runs versus database ../UNIT_TESTER/run/TEST_pt_src.arb |
---|
2085 | |
---|
2086 | bool use_gene_ptserver = false; |
---|
2087 | { |
---|
2088 | const char *arguments[] = { |
---|
2089 | "prgnamefake", |
---|
2090 | "iterate=20", |
---|
2091 | "iterate_amount=10", |
---|
2092 | }; |
---|
2093 | CCP expected = |
---|
2094 | "AAACCGGGGCTAATACCGGA;AAACGACTGTTAATACCGCA;AAACGATGGAAGCTTGCTTC;AAACGATGGCTAATACCGCA;AAACGGATTAGCGGCGGGAC;" |
---|
2095 | "AAACGGGCGCTAATACCGCA;AAACGGTCGCTAATACCGGA;AAACGGTGGCTAATACCGCA;AAACGTACGCTAATACCGCA;AAACTCAAGCTAATACCGCA"; |
---|
2096 | |
---|
2097 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
2098 | } |
---|
2099 | { |
---|
2100 | const char *arguments[] = { |
---|
2101 | "prgnamefake", |
---|
2102 | "iterate=15", |
---|
2103 | "iterate_amount=20", |
---|
2104 | "iterate_separator=:", |
---|
2105 | }; |
---|
2106 | CCP expected = |
---|
2107 | "AAACCGGGGCTAATA:AAACGACTGTTAATA:AAACGATGGAAGCTT:AAACGATGGCTAATA:AAACGGATTAGCGGC:AAACGGGCGCTAATA:AAACGGTCGCTAATA:" |
---|
2108 | "AAACGGTGGCTAATA:AAACGTACGCTAATA:AAACTCAAGCTAATA:AAACTCAGGCTAATA:AAACTGGAGAGTTTG:AAACTGTAGCTAATA:AAACTTGTTTCTCGG:" |
---|
2109 | "AAAGAGGTGCTAATA:AAAGCTTGCTTTCTT:AAAGGAACGCTAATA:AAAGGAAGATTAATA:AAAGGACAGCTAATA:AAAGGGACTTCGGTC"; |
---|
2110 | |
---|
2111 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
2112 | } |
---|
2113 | { |
---|
2114 | const char *arguments[] = { |
---|
2115 | "prgnamefake", |
---|
2116 | "iterate=10", |
---|
2117 | "iterate_amount=5", |
---|
2118 | "iterate_readable=0", |
---|
2119 | }; |
---|
2120 | CCP expected = |
---|
2121 | "\2\2\2\3\3\4\4\4\4\3;\2\2\2\3\4\2\3\5\4\5;\2\2\2\3\4\2\5\4\4\2;\2\2\2\3\4\2\5\4\4\3;\2\2\2\3\4\4\2\5\5\2"; |
---|
2122 | |
---|
2123 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
2124 | } |
---|
2125 | { |
---|
2126 | const char *arguments[] = { |
---|
2127 | "prgnamefake", |
---|
2128 | "iterate=3", |
---|
2129 | "iterate_amount=70", |
---|
2130 | "iterate_tu=U", |
---|
2131 | }; |
---|
2132 | CCP expected = |
---|
2133 | "AAA;AAC;AAG;AAU;ACA;ACC;ACG;ACU;AGA;AGC;AGG;AGU;AUA;AUC;AUG;AUU;" |
---|
2134 | "CAA;CAC;CAG;CAU;CCA;CCC;CCG;CCU;CGA;CGC;CGG;CGU;CUA;CUC;CUG;CUU;" |
---|
2135 | "GAA;GAC;GAG;GAU;GCA;GCC;GCG;GCU;GGA;GGC;GGG;GGU;GUA;GUC;GUG;GUU;" |
---|
2136 | "UAA;UAC;UAG;UAU;UCA;UCC;UCG;UCU;UGA;UGC;UGG;UGU;UUA;UUC;UUG;UUU"; |
---|
2137 | |
---|
2138 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
2139 | } |
---|
2140 | { |
---|
2141 | const char *arguments[] = { |
---|
2142 | "prgnamefake", |
---|
2143 | "iterate=2", |
---|
2144 | "iterate_amount=20", |
---|
2145 | }; |
---|
2146 | CCP expected = |
---|
2147 | "AA;AC;AG;AT;" |
---|
2148 | "CA;CC;CG;CT;" |
---|
2149 | "GA;GC;GG;GT;" |
---|
2150 | "TA;TC;TG;TT"; |
---|
2151 | |
---|
2152 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, expected); |
---|
2153 | } |
---|
2154 | } |
---|
2155 | |
---|
2156 | // #define TEST_AUTO_UPDATE // uncomment to auto-update expected index dumps |
---|
2157 | |
---|
2158 | void TEST_SLOW_index_dump() { |
---|
2159 | for (int use_gene_ptserver = 0; use_gene_ptserver <= 1; use_gene_ptserver++) { |
---|
2160 | const char *dumpfile = use_gene_ptserver ? "index_gpt.dump" : "index_pt.dump"; |
---|
2161 | char *dumpfile_exp = GBS_global_string_copy("%s.expected", dumpfile); |
---|
2162 | |
---|
2163 | const char *arguments[] = { |
---|
2164 | "prgnamefake", |
---|
2165 | GBS_global_string_copy("dump=%s", dumpfile), |
---|
2166 | }; |
---|
2167 | TEST_ARB_PROBE(ARRAY_ELEMS(arguments), arguments, "ok"); |
---|
2168 | |
---|
2169 | #if defined(TEST_AUTO_UPDATE) |
---|
2170 | TEST_COPY_FILE(dumpfile, dumpfile_exp); |
---|
2171 | #else // !defined(TEST_AUTO_UPDATE) |
---|
2172 | TEST_EXPECT_TEXTFILES_EQUAL(dumpfile_exp, dumpfile); |
---|
2173 | #endif |
---|
2174 | TEST_EXPECT_ZERO_OR_SHOW_ERRNO(unlink(dumpfile)); |
---|
2175 | |
---|
2176 | free((char*)arguments[1]); |
---|
2177 | free(dumpfile_exp); |
---|
2178 | } |
---|
2179 | } |
---|
2180 | |
---|
2181 | #undef TEST_AUTO_UPDATE |
---|
2182 | |
---|
2183 | // -------------------------------------------------------------------------------- |
---|
2184 | |
---|
2185 | #include <arb_strarray.h> |
---|
2186 | #include <set> |
---|
2187 | #include <iterator> |
---|
2188 | |
---|
2189 | using namespace std; |
---|
2190 | |
---|
2191 | typedef set<string> Matches; |
---|
2192 | |
---|
2193 | inline void parseMatches(char*& answer, Matches& matches) { |
---|
2194 | ConstStrArray match_results; |
---|
2195 | |
---|
2196 | GBT_splitNdestroy_string(match_results, answer, "\1", false); |
---|
2197 | |
---|
2198 | for (size_t i = 1; i<match_results.size(); i += 2) { |
---|
2199 | if (match_results[i][0]) { |
---|
2200 | matches.insert(match_results[i]); |
---|
2201 | } |
---|
2202 | } |
---|
2203 | } |
---|
2204 | |
---|
2205 | inline void getMatches(const char *probe, Matches& matches) { |
---|
2206 | bool use_gene_ptserver = false; |
---|
2207 | char *matchseq = GBS_global_string_copy("matchsequence=%s", probe); |
---|
2208 | const char *arguments[] = { |
---|
2209 | "prgnamefake", |
---|
2210 | matchseq, |
---|
2211 | }; |
---|
2212 | TEST_RUN_ARB_PROBE(ARRAY_ELEMS(arguments), arguments); |
---|
2213 | parseMatches(answer, matches); |
---|
2214 | free(matchseq); |
---|
2215 | } |
---|
2216 | |
---|
2217 | inline string matches2hitlist(const Matches& matches) { |
---|
2218 | string hitlist; |
---|
2219 | if (!matches.empty()) { |
---|
2220 | for (Matches::const_iterator m = matches.begin(); m != matches.end(); ++m) { |
---|
2221 | hitlist = hitlist + ',' + *m; |
---|
2222 | } |
---|
2223 | hitlist = hitlist.substr(1); |
---|
2224 | } |
---|
2225 | return hitlist; |
---|
2226 | } |
---|
2227 | |
---|
2228 | inline void extract_first_but_not_second(const Matches& first, const Matches& second, Matches& result) { |
---|
2229 | set_difference(first.begin(), first.end(), |
---|
2230 | second.begin(), second.end(), |
---|
2231 | inserter(result, result.begin())); |
---|
2232 | } |
---|
2233 | |
---|
2234 | // -------------------------------------------------------------------------------- |
---|
2235 | |
---|
2236 | // #define TEST_INDEX_COMPLETENESS // only uncomment temporarily (slow as hell) |
---|
2237 | |
---|
2238 | #if defined(TEST_INDEX_COMPLETENESS) |
---|
2239 | |
---|
2240 | void TEST_SLOW_find_unmatched_probes() { |
---|
2241 | bool use_gene_ptserver = false; |
---|
2242 | |
---|
2243 | // get all 20mers indexed in ptserver: |
---|
2244 | ConstStrArray fullProbes; |
---|
2245 | { |
---|
2246 | const char *arguments[] = { |
---|
2247 | "prgnamefake", |
---|
2248 | "iterate=20", |
---|
2249 | "iterate_amount=1000000", |
---|
2250 | "iterate_tu=U", |
---|
2251 | }; |
---|
2252 | TEST_RUN_ARB_PROBE(ARRAY_ELEMS(arguments), arguments); |
---|
2253 | |
---|
2254 | GBT_splitNdestroy_string(fullProbes, answer, ";", false); |
---|
2255 | TEST_EXPECT_EQUAL(fullProbes.size(), 2040); |
---|
2256 | } |
---|
2257 | |
---|
2258 | for (size_t lp = 0; lp<fullProbes.size(); ++lp) { // with all 20mers existing in ptserver |
---|
2259 | const char *fullProbe = fullProbes[lp]; |
---|
2260 | |
---|
2261 | size_t fullLen = strlen(fullProbe); |
---|
2262 | TEST_EXPECT_EQUAL(fullLen, 20); |
---|
2263 | |
---|
2264 | Matches fullHits; |
---|
2265 | getMatches(fullProbe, fullHits); |
---|
2266 | TEST_EXPECT(fullHits.size()>0); |
---|
2267 | |
---|
2268 | bool fewerHitsSeen = false; |
---|
2269 | |
---|
2270 | for (size_t subLen = fullLen-1; !fewerHitsSeen && subLen >= 10; --subLen) { // for each partial sub-probe of 20mer |
---|
2271 | char subProbe[20]; |
---|
2272 | subProbe[subLen] = 0; |
---|
2273 | |
---|
2274 | for (size_t pos = 0; pos+subLen <= fullLen; ++pos) { |
---|
2275 | Matches subHits, onlyFull; |
---|
2276 | |
---|
2277 | memcpy(subProbe, fullProbe+pos, subLen); |
---|
2278 | getMatches(subProbe, subHits); |
---|
2279 | extract_first_but_not_second(fullHits, subHits, onlyFull); |
---|
2280 | |
---|
2281 | if (!onlyFull.empty()) { |
---|
2282 | fprintf(stderr, "TEST_PARTIAL_COVERS_FULL_PROBE__BROKEN(\"%s\", \"%s\");\n", subProbe, fullProbe); |
---|
2283 | fewerHitsSeen = true; // only list first wrong hit for each fullProbe |
---|
2284 | } |
---|
2285 | } |
---|
2286 | } |
---|
2287 | } |
---|
2288 | } |
---|
2289 | |
---|
2290 | #endif |
---|
2291 | // -------------------------------------------------------------------------------- |
---|
2292 | |
---|
2293 | static arb_test::match_expectation partial_covers_full_probe(const char *part, const char *full) { |
---|
2294 | using namespace arb_test; |
---|
2295 | using namespace std; |
---|
2296 | |
---|
2297 | expectation_group expected; |
---|
2298 | expected.add(that(strstr(full, part)).does_differ_from_NULL()); |
---|
2299 | expected.add(that(strlen(part)).is_less_than(strlen(full))); |
---|
2300 | |
---|
2301 | { |
---|
2302 | Matches matchFull, matchPart; |
---|
2303 | getMatches(full, matchFull); |
---|
2304 | getMatches(part, matchPart); |
---|
2305 | |
---|
2306 | expected.add(that(matchFull.empty()).is_equal_to(false)); |
---|
2307 | |
---|
2308 | Matches onlyFirst; |
---|
2309 | extract_first_but_not_second(matchFull, matchPart, onlyFirst); |
---|
2310 | |
---|
2311 | string only_hit_by_full = matches2hitlist(onlyFirst); |
---|
2312 | expected.add(that(only_hit_by_full).is_equal_to("")); |
---|
2313 | } |
---|
2314 | |
---|
2315 | |
---|
2316 | return all().ofgroup(expected); |
---|
2317 | } |
---|
2318 | |
---|
2319 | #define TEST_PARTIAL_COVERS_FULL_PROBE(part,full) TEST_EXPECTATION(partial_covers_full_probe(part, full)) |
---|
2320 | #define TEST_PARTIAL_COVERS_FULL_PROBE__BROKEN(part,full) TEST_EXPECTATION__BROKEN(partial_covers_full_probe(part, full)) |
---|
2321 | |
---|
2322 | void TEST_SLOW_unmatched_probes() { |
---|
2323 | TEST_PARTIAL_COVERS_FULL_PROBE("CCUCCUUUCU", "GAUUAAUACCCCUCCUUUCU"); |
---|
2324 | |
---|
2325 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUC", "GGGGAACCUGCGGUUGGAUC"); |
---|
2326 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCA", "GGGAACCUGCGGUUGGAUCA"); |
---|
2327 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCAC", "GGAACCUGCGGUUGGAUCAC"); |
---|
2328 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCACC", "GAACCUGCGGUUGGAUCACC"); |
---|
2329 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCACCU", "AACCUGCGGUUGGAUCACCU"); |
---|
2330 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCACCUC", "ACCUGCGGUUGGAUCACCUC"); |
---|
2331 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCACCUCC", "CCUGCGGUUGGAUCACCUCC"); |
---|
2332 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCACCUCCU", "CUGCGGUUGGAUCACCUCCU"); |
---|
2333 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCACCUCCUU", "UGCGGUUGGAUCACCUCCUU"); |
---|
2334 | TEST_PARTIAL_COVERS_FULL_PROBE("CGGUUGGAUCACCUCCUUA", "GCGGUUGGAUCACCUCCUUA"); |
---|
2335 | |
---|
2336 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUC", "GGGGAACCUGGCGCUGGAUC"); |
---|
2337 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCA", "GGGAACCUGGCGCUGGAUCA"); |
---|
2338 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCAC", "GGAACCUGGCGCUGGAUCAC"); |
---|
2339 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCACC", "GAACCUGGCGCUGGAUCACC"); |
---|
2340 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCACCU", "AACCUGGCGCUGGAUCACCU"); |
---|
2341 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCACCUC", "ACCUGGCGCUGGAUCACCUC"); |
---|
2342 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCACCUCC", "CCUGGCGCUGGAUCACCUCC"); |
---|
2343 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCACCUCCU", "CUGGCGCUGGAUCACCUCCU"); |
---|
2344 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCACCUCCUU", "UGGCGCUGGAUCACCUCCUU"); |
---|
2345 | TEST_PARTIAL_COVERS_FULL_PROBE("GCGCUGGAUCACCUCCUUU", "GGCGCUGGAUCACCUCCUUU"); |
---|
2346 | |
---|
2347 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCAC", "GGAACCUGCGGCUGGAUCAC"); |
---|
2348 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACC", "GAACCUGCGGCUGGAUCACC"); |
---|
2349 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACCU", "AACCUGCGGCUGGAUCACCU"); |
---|
2350 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACCUC", "ACCUGCGGCUGGAUCACCUC"); |
---|
2351 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACCUCC", "CCUGCGGCUGGAUCACCUCC"); |
---|
2352 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACCUCCU", "CUGCGGCUGGAUCACCUCCU"); |
---|
2353 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACCUCCUU", "UGCGGCUGGAUCACCUCCUU"); |
---|
2354 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACCUCCUUU", "GCGGCUGGAUCACCUCCUUU"); |
---|
2355 | TEST_PARTIAL_COVERS_FULL_PROBE("GCUGGAUCACCUCCUUUC", "CGGCUGGAUCACCUCCUUUC"); |
---|
2356 | |
---|
2357 | // the data of the following tests is located right in front of the dots inserted in [8962] |
---|
2358 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAG", "AAUUGAAGAGUUUGAUCAAG"); |
---|
2359 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGU", "AUUGAAGAGUUUGAUCAAGU"); |
---|
2360 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUC", "UUGAAGAGUUUGAUCAAGUC"); |
---|
2361 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUCG", "UGAAGAGUUUGAUCAAGUCG"); |
---|
2362 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUCGA", "GAAGAGUUUGAUCAAGUCGA"); |
---|
2363 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUCGAG", "AAGAGUUUGAUCAAGUCGAG"); |
---|
2364 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUCGAGC", "AGAGUUUGAUCAAGUCGAGC"); |
---|
2365 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUCGAGCG", "GAGUUUGAUCAAGUCGAGCG"); |
---|
2366 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUCGAGCGG", "AGUUUGAUCAAGUCGAGCGG"); |
---|
2367 | TEST_PARTIAL_COVERS_FULL_PROBE("UUUGAUCAAGUCGAGCGGU", "GUUUGAUCAAGUCGAGCGGU"); |
---|
2368 | } |
---|
2369 | |
---|
2370 | void TEST_SLOW_variable_defaults_in_server() { |
---|
2371 | test_setup(false); |
---|
2372 | |
---|
2373 | const char *server_tag = GBS_ptserver_tag(TEST_SERVER_ID); |
---|
2374 | TEST_EXPECT_NO_ERROR(arb_look_and_start_server(AISC_MAGIC_NUMBER, server_tag)); |
---|
2375 | |
---|
2376 | const char *servername = GBS_read_arb_tcp(server_tag); |
---|
2377 | { |
---|
2378 | char *socketname = GBS_global_string_copy(":%s", GB_path_in_ARBHOME("UNIT_TESTER/sockets/pt.socket")); |
---|
2379 | TEST_EXPECT_EQUAL(servername, socketname); // as defined in ../lib/arb_tcp.dat@ARB_TEST_PT_SERVER |
---|
2380 | free(socketname); |
---|
2381 | } |
---|
2382 | |
---|
2383 | T_PT_MAIN com; |
---|
2384 | T_PT_LOCS locs; |
---|
2385 | GB_ERROR error = NULL; |
---|
2386 | aisc_com *link = aisc_open(servername, com, AISC_MAGIC_NUMBER, &error); |
---|
2387 | TEST_EXPECT_NO_ERROR(error); |
---|
2388 | TEST_REJECT_NULL(link); |
---|
2389 | |
---|
2390 | TEST_EXPECT_ZERO(aisc_create(link, PT_MAIN, com, |
---|
2391 | MAIN_LOCS, PT_LOCS, locs, |
---|
2392 | NULL)); |
---|
2393 | |
---|
2394 | { |
---|
2395 | #define LOCAL(rvar) (prev_read_##rvar) |
---|
2396 | |
---|
2397 | |
---|
2398 | #define FREE_LOCAL_long(rvar) |
---|
2399 | #define FREE_LOCAL_charp(rvar) free(LOCAL(rvar)) |
---|
2400 | #define FREE_LOCAL(type,rvar) FREE_LOCAL_##type(rvar) |
---|
2401 | |
---|
2402 | #define TEST__READ(type,rvar,expected) \ |
---|
2403 | do { \ |
---|
2404 | TEST_EXPECT_ZERO(aisc_get(link, PT_LOCS, locs, rvar, &(LOCAL(rvar)), NULL)); \ |
---|
2405 | TEST_EXPECT_EQUAL(LOCAL(rvar), expected); \ |
---|
2406 | FREE_LOCAL(type,rvar); \ |
---|
2407 | } while(0) |
---|
2408 | #define TEST_WRITE(type,rvar,val) \ |
---|
2409 | TEST_EXPECT_ZERO(aisc_put(link, PT_LOCS, locs, rvar, (type)val, NULL)) |
---|
2410 | #define TEST_CHANGE(type,rvar,val) \ |
---|
2411 | do { \ |
---|
2412 | TEST_WRITE(type, rvar, val); \ |
---|
2413 | TEST__READ(type, rvar, val); \ |
---|
2414 | } while(0) |
---|
2415 | #define TEST_DEFAULT_CHANGE(ctype,type,remote_variable,default_value,other_value) \ |
---|
2416 | do { \ |
---|
2417 | ctype DEFAULT_VALUE = default_value; \ |
---|
2418 | ctype OTHER_VALUE = other_value; \ |
---|
2419 | type LOCAL(remote_variable); \ |
---|
2420 | TEST__READ(type, remote_variable, DEFAULT_VALUE); \ |
---|
2421 | TEST_CHANGE(type, remote_variable, OTHER_VALUE); \ |
---|
2422 | TEST_CHANGE(type, remote_variable, DEFAULT_VALUE); \ |
---|
2423 | } while(0) |
---|
2424 | |
---|
2425 | TEST_DEFAULT_CHANGE(const long, long, LOCS_MATCH_REVERSED, 1, 67); |
---|
2426 | typedef char *charp; |
---|
2427 | typedef const char *ccharp; |
---|
2428 | TEST_DEFAULT_CHANGE(ccharp, charp, LOCS_LOGINTIME, "notime", "sometime"); |
---|
2429 | } |
---|
2430 | |
---|
2431 | TEST_EXPECT_ZERO(aisc_close(link, com)); |
---|
2432 | link = 0; |
---|
2433 | } |
---|
2434 | |
---|
2435 | #endif // UNIT_TESTS |
---|