source: branches/sina/UNIT_TESTER/run/tools/arb_replace_2.out

Last change on this file was 7156, checked in by westram, 15 years ago
  • added unit tests for mosts tools in TOOLS. Tests do not try to test complete functionality - they only check that one or a few calls to the tools do not fail.
File size: 1.6 KB
Line 
1/*ARBDB ASCII*/
2presets                 %% (%
3        alignment               %% (%
4                alignment_name          ( ali_genom )
5                alignment_len           %i 66
6                %) /*alignment*/
7        use                     ( ali_genom )
8        %) /*presets*/
9species_data            %% (%
10        species         %% (%
11                name ( genome1 )
12                ali_genom               %% (%
13                        data                    ( AUUCUGGUUGAUCCUGCCAGAGGUUACUGCUAUCGGUGUUCGCCUAAGCCAUGCGAGUCAUAUGUA )
14                        %) /*ali_genom*/
15                gene_data               %% (%
16                        gene            %% (%
17                                name ( gene1 )
18                                pos_start ( 3 )
19                                pos_stop ( 6 )
20                                pos_complement ( 0 )
21                                %) /*gene*/
22                        gene            %% (%
23                                name ( gene2 )
24                                pos_start ( 9 )
25                                pos_stop ( 17 )
26                                pos_complement ( 0 )
27                                %) /*gene*/
28                        gene            %% (%
29                                name ( gene3 )
30                                pos_start ( 4 )
31                                pos_stop ( 11 )
32                                pos_complement ( 1 )
33                                %) /*gene*/
34                        gene            %% (%
35                                name ( joined1 )
36                                pos_joined %i 2
37                                pos_start ( 4,7 )
38                                pos_stop ( 11,17 )
39                                pos_complement ( 0,1 )
40                                %) /*gene*/
41                        %) /*gene_data*/
42                %) /*species*/
43        %) /*species_data*/
Note: See TracBrowser for help on using the repository browser.