1 | %! *** Created by Liken: Thu Sep 16 09:42:20 1993 |
---|
2 | %!PS-Adobe-2.0 |
---|
3 | %%Title: GDE2.2 |
---|
4 | %%Creator: Microsoft Word |
---|
5 | %%CreationDate: Thursday, September 16, 1993 |
---|
6 | %%Pages: (atend) |
---|
7 | %%BoundingBox: ? ? ? ? |
---|
8 | %%PageBoundingBox: 30 31 582 761 |
---|
9 | %%For: |
---|
10 | %%BeginProcSet: "(AppleDict md)" 68 0 |
---|
11 | %%Title: "Laser Prep -- The Apple PostScript Dictionary (md)" |
---|
12 | %%Creator: Apple Software Engineering |
---|
13 | %%CreationDate: Thursday, March 19, 1987 |
---|
14 | %{appledict version #68 0 |
---|
15 | % (C) CopyRight Apple Computer, Inc. 1984,1985,1986,1987,1988 All Rights Reserved. |
---|
16 | %%EndComments |
---|
17 | /sc {60 45 {abs exch abs 2 copy add 1 gt{1.0 sub dup mul exch 1.0 sub dup mul add 1.0 sub}{dup mul exch dup mul add 1.0 exch sub} |
---|
18 | ifelse}setscreen} bind def statusdict begin product(LaserWriter II)anchorsearch end |
---|
19 | {pop pop/letter [/letter load /exec load /sc load /exec load]cvx def/legal [/legal load /exec load /sc load /exec load]cvx def/a4 [/a4 load /exec load /sc load /exec load]cvx def/b5 [/b5 load /exec load /sc load /exec load]cvx def |
---|
20 | /lettersmall [/lettersmall load /exec load /sc load /exec load]cvx def/a4small [/a4small load /exec load /sc load /exec load]cvx def/note [/note load /exec load /sc load /exec load]cvx def}{pop}ifelse |
---|
21 | systemdict/currentpacking known{currentpacking true setpacking}if |
---|
22 | /LW{save statusdict/product get(LaserWriter)anchorsearch |
---|
23 | exch pop{length 0 eq{1}{2}ifelse}{0}ifelse exch restore}bind def |
---|
24 | /LW+{LW 2 eq}bind def |
---|
25 | /ok{systemdict/statusdict known dup{LW 0 gt and}if}bind def |
---|
26 | /md 250 dict def md begin |
---|
27 | /av 0 def |
---|
28 | /T true def/F false def/mtx matrix def/s75 75 string def/s8 8 string def/s1 ( ) def/pxs 1 def/pys 1 def |
---|
29 | 1 0 mtx defaultmatrix dtransform exch atan/pa exch def/nlw .24 def/ppr [-32 -29.52 762 582.48] def |
---|
30 | /pgs 1 def/por true def/xb 500 array def/so true def/tso true def/fillflag false def/pnm 1 def/fmv true def |
---|
31 | /sfl false def/ma 0 def/invertflag false def/dbinvertflag false def/xflip false def/yflip false def/noflips true def/scaleby96 false def/fNote true def/fBitStretch true def |
---|
32 | /fg (Rvd\001\001\000\000\177) def |
---|
33 | /bdf{bind def}bind def |
---|
34 | /xdf{exch def}bdf |
---|
35 | /xl{neg exch neg translate}bdf |
---|
36 | /fp{pnsh 0 ne pnsv 0 ne and}bdf |
---|
37 | /nop{}bdf/lnop[/nop load]cvx bdf |
---|
38 | /vrb[ |
---|
39 | {fp{fg 6 get 0 ne{gsave stroke grestore}{gsave 1 setlinewidth pnsh pnsv scale stroke grestore}ifelse}if newpath}bind |
---|
40 | /eofill load |
---|
41 | dup |
---|
42 | /newpath load |
---|
43 | 2 index |
---|
44 | dup |
---|
45 | {clip newpath}bind |
---|
46 | {}bind |
---|
47 | dup |
---|
48 | 2 copy |
---|
49 | ]def |
---|
50 | currentscreen/spf xdf/rot xdf/freq xdf |
---|
51 | /doop{vrb exch get exec}bdf |
---|
52 | /psu{/tso xdf /fNote xdf/fBitStretch xdf/scaleby96 xdf/yflip xdf/xflip xdf |
---|
53 | /invertflag xdf/dbinvertflag invertflag statusdict begin version cvr 47.0 ge product (LaserWriter) eq not and end invertflag and {not}if def |
---|
54 | xflip yflip or{/noflips false def}if |
---|
55 | /pgs xdf 2 index .72 mul exch div/pys xdf div .72 mul/pxs xdf ppr astore pop/por xdf sn and/so xdf}bdf |
---|
56 | /tab{statusdict /11x17 known{statusdict begin /11x17 load end}{statusdict /setpage known{statusdict begin 792 1224 1 setpage end}{statusdict /setpageparams known{statusdict begin 792 1224 0 1 setpageparams end}if}ifelse}ifelse}bdf |
---|
57 | /txpose{fNote{smalls}{bigs}ifelse pgs get exec pxs pys scale ppr aload pop por{noflips{pop exch neg exch translate pop 1 -1 scale}if |
---|
58 | xflip yflip and{pop exch neg exch translate 180 rotate 1 -1 scale ppr 3 get ppr 1 get neg sub neg ppr 2 get ppr 0 get neg sub neg translate}if |
---|
59 | xflip yflip not and{pop exch neg exch translate pop 180 rotate ppr 3 get ppr 1 get neg sub neg 0 translate}if yflip xflip not and{ppr 1 get neg ppr 0 get neg translate}if} |
---|
60 | {noflips{translate pop pop 270 rotate 1 -1 scale}if xflip yflip and{translate pop pop 90 rotate 1 -1 scale ppr 3 get ppr 1 get neg sub neg ppr 2 get ppr 0 get neg sub neg translate}if |
---|
61 | xflip yflip not and{translate pop pop 90 rotate ppr 3 get ppr 1 get neg sub neg 0 translate}if yflip xflip not and{translate pop pop 270 rotate ppr 2 get ppr 0 get neg sub neg 0 exch translate}if}ifelse |
---|
62 | scaleby96{ppr aload pop 4 -1 roll add 2 div 3 1 roll add 2 div 2 copy translate .96 dup scale neg exch neg exch translate}if}bdf |
---|
63 | /fr{4 copy ppr aload pop 3 -1 roll add 3 1 roll exch add 6 2 roll 3 -1 roll |
---|
64 | sub 3 1 roll exch sub 3 -1 roll exch div 3 1 roll div exch scale pop pop xl}bdf |
---|
65 | /obl{{0.212557 mul}{pop 0}ifelse}bdf |
---|
66 | /sfd{ps fg 5 -1 roll get mul 100 div 0 ps 5 -1 roll obl ps neg 0 0 6a astore makefont setfont}bdf |
---|
67 | /fnt{findfont sfd}bdf |
---|
68 | /bt{sa 3 1 roll 3 index and put}bdf |
---|
69 | /sa(\000\000\000\000\000\000\000\000\000\000)def |
---|
70 | /fs{0 1 bt 1 2 bt 2 4 bt 3 8 bt 4 16 bt 5 32 bt 6 64 bt 7 128 bt sa exch 8 exch put}bdf |
---|
71 | /mx1 matrix def |
---|
72 | /mx2 matrix def |
---|
73 | /mx3 matrix def |
---|
74 | /bu{currentpoint currentgray currentlinewidth currentlinecap currentlinejoin currentdash exch aload length |
---|
75 | fg 5 sfl{1}{0}ifelse put pnsv pnsh |
---|
76 | 2t aload pop 3a aload pop mx2 aload pop mx1 aload pop mtx currentmatrix aload pop |
---|
77 | mx3 aload pop ps pm restore/ps xdf mx3 astore pop}bdf |
---|
78 | /bn{/pm save def mx3 setmatrix newpath 0 0 moveto ct dup 39 get 0 exch getinterval cvx exec |
---|
79 | mtx astore setmatrix mx1 astore pop mx2 astore pop 3a astore pop |
---|
80 | 2t astore pop/pnsh xdf/pnsv xdf gw |
---|
81 | /sfl fg 5 get 0 ne def array astore exch setdash setlinejoin setlinecap |
---|
82 | setlinewidth setgray moveto}bdf |
---|
83 | /fc{save vmstatus exch sub 50000 lt |
---|
84 | {(%%[|0|]%%)=print flush}if pop restore}bdf |
---|
85 | /tc{32768 div add 3 1 roll 32768 div add 2t astore pop}bdf |
---|
86 | /3a [0 0 0] def |
---|
87 | /2t 2 array def |
---|
88 | /tp{3a astore pop}bdf |
---|
89 | /tt{mx2 currentmatrix pop currentpoint 2 copy 2t aload pop qa 2 copy translate 3a aload pop exch dup 0 eq |
---|
90 | {pop}{1 eq{-1 1}{1 -1}ifelse scale}ifelse rotate pop neg exch neg exch translate moveto}bdf |
---|
91 | /te{mx2 setmatrix}bdf |
---|
92 | /th{3 -1 roll div 3 1 roll exch div 2 copy mx1 scale pop scale/sfl true def}bdf |
---|
93 | /tu{1 1 mx1 itransform scale/sfl false def}bdf |
---|
94 | /ts{1 1 mx1 transform scale/sfl true def}bdf |
---|
95 | /fz{/ps xdf}bdf |
---|
96 | /dv{dup 0 ne{div}{pop}ifelse}bdf |
---|
97 | /pop4{pop pop pop pop}bdf |
---|
98 | /it{sfl{mx1 itransform}if}bdf |
---|
99 | /gm{exch it moveto}bdf/rm{it rmoveto}bdf |
---|
100 | /lm{currentpoint sfl{mx1 transform}if exch pop sub 0 exch it rmoveto}bdf |
---|
101 | /fm{statusdict/manualfeed known}bdf |
---|
102 | /se{statusdict exch/manualfeed exch put}bdf |
---|
103 | /mf{dup/ma exch def 0 gt{fm se/t1 5 st ok ma 1 gt and{/t2 0 st/t3 0 st |
---|
104 | statusdict/manualfeedtimeout 3600 put |
---|
105 | }if}if}bdf |
---|
106 | /jn{/statusdict where exch pop{statusdict exch /jobname exch put}if}bdf |
---|
107 | /pen{pnm mul/pnsh xdf pnm mul/pnsv xdf pnsh setlinewidth}bdf |
---|
108 | /min{2 copy gt{exch}if pop}bdf |
---|
109 | /max{2 copy lt{exch}if pop}bdf |
---|
110 | /dh{fg 6 1 put array astore dup {1 pxs div mul exch}forall astore exch pop exch pop exch setdash}bdf |
---|
111 | /ih[currentdash]def |
---|
112 | /rh{fg 6 0 put ih aload pop setdash}bdf |
---|
113 | /dl{gsave nlw pys div setlinewidth 0 setgray}bdf |
---|
114 | /dlin{exch currentpoint currentlinewidth 2 div dup |
---|
115 | translate newpath moveto lineto currentpoint stroke grestore moveto}bdf |
---|
116 | /lin{fg 6 get 0 ne{exch lineto currentpoint 0 doop moveto} |
---|
117 | {exch currentpoint/pnlv xdf/pnlh xdf gsave newpath/@1 xdf/@2 xdf fp{pnlh @2 lt{pnlv @1 ge |
---|
118 | {pnlh pnlv moveto @2 @1 lineto pnsh 0 rlineto |
---|
119 | 0 pnsv rlineto pnlh pnsh add pnlv pnsv add lineto pnsh neg 0 rlineto} |
---|
120 | {pnlh pnlv moveto pnsh 0 rlineto @2 pnsh add @1 lineto 0 pnsv rlineto |
---|
121 | pnsh neg 0 rlineto pnlh pnlv pnsv add lineto}ifelse}{pnlv @1 gt |
---|
122 | {@2 @1 moveto pnsh 0 rlineto pnlh pnsh add pnlv lineto 0 pnsv rlineto |
---|
123 | pnsh neg 0 rlineto @2 @1 pnsv add lineto}{pnlh pnlv moveto pnsh 0 rlineto |
---|
124 | 0 pnsv rlineto @2 pnsh add @1 pnsv add lineto pnsh neg 0 rlineto |
---|
125 | 0 pnsv neg rlineto}ifelse}ifelse |
---|
126 | closepath fill}if @2 @1 grestore moveto}ifelse}bdf |
---|
127 | /gw{/pnm fg 3 get fg 4 get div def}bdf |
---|
128 | /lw{fg exch 4 exch put fg exch 3 exch put gw pnsv pnsh pen}bdf |
---|
129 | /barc{/@1 xdf/@2 xdf/@3 xdf/@4 xdf/@5 xdf |
---|
130 | /@6 xdf/@7 xdf/@8 xdf gsave |
---|
131 | @5 @7 add 2 div @6 @8 add 2 div translate newpath 0 0 moveto |
---|
132 | @5 @7 sub @6 @8 sub mtx currentmatrix pop scale @1{newpath}if |
---|
133 | 0 0 0.5 @4 @3 arc @4 @3 sub abs 360 ge{closepath}if |
---|
134 | mtx setmatrix @2 doop grestore}bdf |
---|
135 | /ar{dup 0 eq barc}bdf |
---|
136 | /ov{0 exch 360 exch true barc}bdf |
---|
137 | /rc{/@t xdf currentpoint 6 2 roll newpath 4 copy 4 2 roll exch moveto |
---|
138 | 6 -1 roll lineto lineto lineto closepath @t doop moveto}bdf |
---|
139 | /mup{dup pnsh 2 div le exch pnsv 2 div le or}bdf |
---|
140 | /rr{/@1 xdf 2. div/@2 xdf 2. div/@3 xdf |
---|
141 | /@4 xdf/@5 xdf/@6 xdf/@7 xdf |
---|
142 | @7 @5 eq @6 @4 eq @2 mup or or{@7 @6 @5 @4 @1 rc} |
---|
143 | {@4 @6 sub 2. div dup @2 lt{/@2 xdf}{pop}ifelse |
---|
144 | @5 @7 sub 2. div dup @2 lt{/@2 xdf}{pop}ifelse |
---|
145 | @1 0 eq{/@2 @2 pnsh 2 div 2 copy gt{sub def}{0 pop4}ifelse}if |
---|
146 | currentpoint newpath |
---|
147 | @4 @6 add 2. div @7 moveto |
---|
148 | @4 @7 @4 @5 @2 arcto pop4 |
---|
149 | @4 @5 @6 @5 @2 arcto pop4 |
---|
150 | @6 @5 @6 @7 @2 arcto pop4 |
---|
151 | @6 @7 @4 @7 @2 arcto pop4 |
---|
152 | closepath @1 doop moveto}ifelse}bdf |
---|
153 | /pr{gsave newpath/pl{exch moveto/pl{exch lineto}def}def}bdf |
---|
154 | /pl{exch lineto}bdf |
---|
155 | /ep{dup 0 eq{{moveto}{exch lin}{}{(%%[|1|]%%)= flush}pathforall |
---|
156 | pop grestore}{doop grestore}ifelse currentpoint newpath moveto}bdf |
---|
157 | /gr{64. div setgray}bdf |
---|
158 | /pat{s8 copy pop 9.375 pa por not{90 add}if{1 add 4 mul cvi s8 exch get exch 1 add 4 mul cvi 7 sub bitshift 1 and}setscreen gr}bdf |
---|
159 | /sg{freq rot/spf load setscreen gr}bdf |
---|
160 | /dc{transform round .5 sub exch round .5 sub exch itransform}bdf |
---|
161 | /sn{userdict/smooth4 known}bdf |
---|
162 | /x8{3 bitshift}bdf |
---|
163 | /x4{2 bitshift}bdf |
---|
164 | /d4{-2 bitshift}bdf |
---|
165 | /d8{-3 bitshift}bdf |
---|
166 | /rb{15 add -4 bitshift 1 bitshift}bdf |
---|
167 | /db{/@7 save def/@1 xdf/@2 xdf/@3 xdf/@4 xdf/@5 xdf/@6 @5 @3 4 add mul def |
---|
168 | dc translate scale/xdbit 1 1 idtransform abs/ydbit exch def abs def{0 0 1 ydbit add 1 10 rc clip}if |
---|
169 | @1 0 eq @1 4 eq or{1 setgray ydbit 0 1 ydbit add 1 2 rc}if |
---|
170 | @1 3 eq @1 7 eq or{1}{0}ifelse setgray/@9 @1 0 eq @1 1 eq @1 3 eq or or dbinvertflag xor def/@13 @6 def |
---|
171 | @2 fBitStretch or{/@10 @4 x4 def/@11 @3 x4 def/@12 @10 rb def/@13 @12 @11 mul def/@15 1 1 dtransform abs/calcY 1 index def round cvi/@14 exch def |
---|
172 | abs/calcX 1 index def round cvi scaleby96 not{1 add}if def/@16 @15 rb def/@17 @16 @14 mul def}if |
---|
173 | sn @13 60000 lt and @2 fBitStretch or and{mtx currentmatrix dup 1 get exch 2 get 0. eq exch 0. eq and @17 60000 lt and fBitStretch and{@16 3 bitshift @14 @9 [calcX 0 0 calcY 0 0]{@17 string @13 string |
---|
174 | currentfile @6 string readhexstring pop 1 index @4 @3 @5 @12 @2 smooth4 |
---|
175 | @10 @11 @12 dup string 5 index @15 @14 @16 dup string stretch}imagemask}{@12 x8 @11 @9 [@10 0 0 @11 0 0]{@13 string |
---|
176 | currentfile @6 string readhexstring pop 1 index @4 @3 @5 @12 @2 smooth4}imagemask}ifelse}{@5 3 bitshift @3 4 add @9 [@4 0 0 @3 0 2]{currentfile @6 string readhexstring pop}imagemask}ifelse |
---|
177 | @7 restore}bdf |
---|
178 | /multibit{/mbdeep exch def/mbY exch def/mbX exch def |
---|
179 | save mbX mbY mbdeep[mbX 0 0 mbY 0 0]{currentfile picstr readhexstring pop}image |
---|
180 | restore}bdf |
---|
181 | /wd 16 dict def |
---|
182 | /mfont 14 dict def |
---|
183 | /mdf{mfont wcheck not{/mfont 14 dict def}if mfont begin xdf end}bdf |
---|
184 | /cf{{1 index/FID ne{def}{pop pop}ifelse}forall}bdf/rf{/@1 exch def/@2 exch def |
---|
185 | FontDirectory @2 known{cleartomark pop}{findfont dup begin dup length @1 add dict begin |
---|
186 | cf{/Encoding macvec def}{Encoding dup length array copy/Encoding exch def |
---|
187 | counttomark 2 idiv{Encoding 3 1 roll put}repeat}ifelse |
---|
188 | pop |
---|
189 | exec currentdict end end @2 exch definefont pop}ifelse}bdf |
---|
190 | /bmbc{exch begin wd begin |
---|
191 | /cr xdf |
---|
192 | save |
---|
193 | CharTable cr 6 mul 6 getinterval{}forall |
---|
194 | /bitheight xdf/bitwidth xdf |
---|
195 | .96 div/width xdf |
---|
196 | Gkernmax add/XOffset xdf Gdescent add/YOffset xdf/rowbytes xdf |
---|
197 | rowbytes 255 eq{0 0 0 0 0 0 setcachedevice} |
---|
198 | {Gnormsize dup scale |
---|
199 | width 0 XOffset YOffset bitwidth XOffset add bitheight YOffset add |
---|
200 | setcachedevice |
---|
201 | rowbytes 0 ne{ |
---|
202 | XOffset YOffset translate newpath 0 0 moveto |
---|
203 | bitwidth bitheight scale |
---|
204 | sn{ |
---|
205 | /xSmt bitwidth x4 def |
---|
206 | /ySmt bitheight x4 def |
---|
207 | /rSmt xSmt rb def |
---|
208 | rSmt x8 ySmt true |
---|
209 | [xSmt 0 0 ySmt neg 0 ySmt] |
---|
210 | {rSmt ySmt mul string CharData cr get |
---|
211 | 1 index bitwidth bitheight rowbytes rSmt tso smooth4} |
---|
212 | }{rowbytes 3 bitshift bitheight 4 add true |
---|
213 | [bitwidth 0 0 bitheight neg 0 bitheight 2 add] |
---|
214 | {CharData cr get} |
---|
215 | }ifelse |
---|
216 | imagemask |
---|
217 | }if |
---|
218 | }ifelse |
---|
219 | restore |
---|
220 | end end |
---|
221 | }bdf |
---|
222 | /bb{.96 exch div/Gnormsize mdf 2 index |
---|
223 | /Gkernmax mdf 1 index/Gdescent mdf |
---|
224 | 3 index div 4 1 roll |
---|
225 | 2 index div 1. 5 2 roll |
---|
226 | exch div 4 1 roll |
---|
227 | 4 array astore/FontBBox mdf |
---|
228 | }bdf |
---|
229 | /cdf{mfont/CharData get 3 1 roll put}bdf |
---|
230 | /bf{ |
---|
231 | mfont begin |
---|
232 | /FontType 3 def |
---|
233 | /FontMatrix [1 0 0 1 0 0] def |
---|
234 | /Encoding macvec def |
---|
235 | /BuildChar/bmbc load def |
---|
236 | end |
---|
237 | mfont definefont pop |
---|
238 | }bdf |
---|
239 | /wi LW 1 eq{{gsave 0 0 0 0 0 0 0 0 moveto lineto lineto lineto closepath clip stringwidth grestore}bind}{/stringwidth load}ifelse def |
---|
240 | /aps{0 get 124 eq}bdf |
---|
241 | /xc{s75 cvs dup}bdf |
---|
242 | /xp{put cvn}bdf |
---|
243 | /scs{xc 3 67 put dup 0 95 xp}bdf |
---|
244 | /sos{xc 3 79 xp}bdf |
---|
245 | /sbs{xc 1 66 xp}bdf |
---|
246 | /sis{xc 2 73 xp}bdf |
---|
247 | /sob{xc 2 79 xp}bdf |
---|
248 | /sss{xc 4 83 xp}bdf |
---|
249 | /dd{exch 1 index add 3 1 roll add exch}bdf |
---|
250 | /smc{moveto dup show}bdf |
---|
251 | /kwn{FontDirectory 1 index known{findfont exch pop}}bdf |
---|
252 | /gl{1 currentgray sub setgray}bdf |
---|
253 | /mm{/mfont 10 dict def mfont begin |
---|
254 | /FontMatrix [1 0 0 1 0 0] def |
---|
255 | /FontType 3 def |
---|
256 | /Encoding macvec def |
---|
257 | /df 4 index findfont def |
---|
258 | /FontBBox [0 0 1 1] def |
---|
259 | /xda xdf/mbc xdf |
---|
260 | /BuildChar{wd begin/cr xdf/fd xdf/cs s1 dup 0 cr put def fd/mbc get exec end}def |
---|
261 | exec end mfont definefont}bdf |
---|
262 | /ac{dup scs kwn{exch findfont dup length 1 add dict begin{1 index/FID ne 2 index/UniqueID ne and{def}{pop pop}ifelse}forall |
---|
263 | fmv{/Encoding macvec def}if/StrokeWidth nlw 1000 mul pys div ps div dup 12 lt{pop 12}if def |
---|
264 | /PaintType 2 def currentdict end definefont}ifelse}bdf |
---|
265 | /mb{dup sbs kwn{exch{pop}{bbc}{}mm}ifelse sfd}bdf |
---|
266 | /mo{dup sos kwn{exch{pop}{boc}{}mm}ifelse sfd}bdf |
---|
267 | /ms{dup sss kwn{exch{pop}{bsc}{}mm}ifelse sfd}bdf |
---|
268 | /ou{dup sos kwn{exch dup ac pop{scs findfont /df2 xdf}{aoc}{}mm}ifelse sfd}bdf |
---|
269 | /su{dup sss kwn{exch dup ac pop{scs findfont /df2 xdf}{asc}{}mm}ifelse sfd}bdf |
---|
270 | /ao{/fmv true def ou}bdf/as{/fmv true def su}bdf |
---|
271 | /vo{/fmv false def ou}bdf/vs{/fmv false def su}bdf |
---|
272 | /bbc{/da .03 def fd/df get setfont |
---|
273 | gsave cs wi 1 index 0 ne{exch da add exch}if grestore setcharwidth |
---|
274 | cs 0 0 smc da 0 smc da da smc 0 da moveto show}bdf |
---|
275 | /boc{/da 1 ps div def fd/df get setfont |
---|
276 | gsave cs wi 1 index 0 ne{exch da add exch}if grestore setcharwidth |
---|
277 | cs 0 0 smc da 0 smc da da smc 0 da smc gl da 2. div dup moveto show}bdf |
---|
278 | /bsc{/da 1 ps div def |
---|
279 | /ds .05 def/da2 da 2. div def fd/df get setfont |
---|
280 | gsave cs wi 1 index 0 ne{exch ds add da2 add exch}if grestore setcharwidth |
---|
281 | cs ds da2 add .01 add 0 smc 0 ds da2 sub translate 0 0 smc |
---|
282 | da 0 smc da da smc 0 da smc gl da 2. div dup moveto show}bdf |
---|
283 | /aoc{fd/df get setfont |
---|
284 | gsave cs wi grestore setcharwidth |
---|
285 | gl cs 0 0 smc fd/df2 get setfont gl 0 0 moveto show}bdf |
---|
286 | /asc{/da .05 def fd/df get setfont |
---|
287 | gsave cs wi 1 index 0 ne{exch da add exch}if grestore setcharwidth |
---|
288 | cs da .01 add 0 smc 0 da translate gl 0 0 smc gl fd/df2 get setfont 0 0 moveto show}bdf |
---|
289 | /st{1000 mul usertime add dup 2147483647 gt{2147483647 sub}if def}bdf |
---|
290 | /the{usertime sub dup 0 lt exch -2147483648 gt and}bdf |
---|
291 | /6a 6 array def |
---|
292 | /2a 2 array def |
---|
293 | /3q 3 array def |
---|
294 | /qs{3 -1 roll sub exch 3 -1 roll sub exch}bdf |
---|
295 | /qa{3 -1 roll add exch 3 -1 roll add exch}bdf |
---|
296 | /qm{3 -1 roll 1 index mul 3 1 roll mul}bdf |
---|
297 | /qn{6a exch get mul}bdf |
---|
298 | /qA .166667 def/qB .833333 def/qC .5 def |
---|
299 | /qx{6a astore pop |
---|
300 | qA 0 qn qB 2 qn add qA 1 qn qB 3 qn add |
---|
301 | qB 2 qn qA 4 qn add qB 3 qn qA 5 qn add |
---|
302 | qC 2 qn qC 4 qn add qC 3 qn qC 5 qn add}bdf |
---|
303 | /qp{6 copy 12 -2 roll pop pop}bdf |
---|
304 | /qc{exch qp qx curveto}bdf |
---|
305 | /qi{{exch 4 copy 2a astore aload pop qa .5 qm newpath moveto}{exch 2 copy 6 -2 roll 2 qm qs 4 2 roll}ifelse}bdf |
---|
306 | /qq{{qc 2a aload pop qx curveto}{exch 4 copy qs qa qx curveto}ifelse}bdf |
---|
307 | /pt{currentpoint newpath moveto}bdf |
---|
308 | /qf{/fillflag true def}bdf |
---|
309 | /ec{1 and 0 ne{0 doop}if grestore currentpoint newpath moveto/fillflag false def}bdf |
---|
310 | /eu{currentpoint fp{0 ep}{grestore newpath}ifelse moveto/fillflag false def}bdf |
---|
311 | /bp{currentpoint newpath 2 copy moveto}bdf |
---|
312 | /ef{gsave fillflag{gsave eofill grestore}if}bdf |
---|
313 | /sm{0 exch{@1 eq{1 add}if}forall}bdf |
---|
314 | /lshow{4 1 roll exch/@1 exch def{1 index wi pop sub 1 index sm dv 0 @1 4 -1 roll widthshow}{1 index wi pop sub |
---|
315 | 1 index dup sm 10 mul exch length 1 sub add dv dup 10. mul 0 @1 4 -1 roll 0 6 -1 roll awidthshow}ifelse}bdf |
---|
316 | /setTxMode{sa 9 2 index put 3 eq{1}{0}ifelse setgray}bdf |
---|
317 | /SwToSym{{}mark false/Symbol/|______Symbol 0 rf 0 sa 6 get 0 ne{pop 1}{sa 7 get 0 eq{pop 2}if}ifelse |
---|
318 | sa 1 get 0 ne/|______Symbol |
---|
319 | sa 4 get 0 ne{vs}{sa 3 get 0 ne{vo}{fnt}ifelse}ifelse}bdf |
---|
320 | /mc{0 3 1 roll transform neg exch pop}bdf |
---|
321 | /ul{dup 0 ne sa 2 get 0 ne and{gsave 0 0 |
---|
322 | /UnderlinePosition kif{mc}{ps -10 div}ifelse/UnderlineThickness kif{mc}{ps 15 div}ifelse |
---|
323 | abs setlinewidth neg rmoveto |
---|
324 | sa 4 get 0 ne{gsave currentlinewidth 2. div dup rmoveto currentpoint newpath moveto |
---|
325 | 2 copy rlineto stroke grestore}if |
---|
326 | sa 3 get sa 4 get or 0 ne{gsave gl 2 copy rlineto stroke grestore rlineto strokepath nlw pys div setlinewidth}{rlineto}ifelse |
---|
327 | stroke grestore}{pop}ifelse}bdf |
---|
328 | /sgt{2 copy known{get true}{pop pop false}ifelse}bdf |
---|
329 | /kif{currentfont dup/FontMatrix get exch/FontInfo sgt{true}{currentfont/df sgt |
---|
330 | {dup/FontInfo sgt{3 1 roll/FontMatrix get mtx concatmatrix exch true}{pop pop pop false} |
---|
331 | ifelse}{pop pop false}ifelse}ifelse{3 -1 roll sgt{exch true}{pop false}ifelse}{false}ifelse}bdf |
---|
332 | /blank/Times-Roman findfont/CharStrings get/space get def |
---|
333 | /macvec 256 array def |
---|
334 | /NUL/SOH/STX/ETX/EOT/ENQ/ACK/BEL/BS/HT/LF/VT/FF/CR/SO/SI |
---|
335 | /DLE/DC1/DC2/DC3/DC4/NAK/SYN/ETB/CAN/EM/SUB/ESC/FS/GS/RS/US |
---|
336 | macvec 0 32 getinterval astore pop |
---|
337 | macvec 32/Times-Roman findfont/Encoding get |
---|
338 | 32 96 getinterval putinterval macvec dup 39/quotesingle put 96/grave put |
---|
339 | /Adieresis/Aring/Ccedilla/Eacute/Ntilde/Odieresis/Udieresis/aacute |
---|
340 | /agrave/acircumflex/adieresis/atilde/aring/ccedilla/eacute/egrave |
---|
341 | /ecircumflex/edieresis/iacute/igrave/icircumflex/idieresis/ntilde/oacute |
---|
342 | /ograve/ocircumflex/odieresis/otilde/uacute/ugrave/ucircumflex/udieresis |
---|
343 | /dagger/degree/cent/sterling/section/bullet/paragraph/germandbls |
---|
344 | /registered/copyright/trademark/acute/dieresis/notequal/AE/Oslash |
---|
345 | /infinity/plusminus/lessequal/greaterequal/yen/mu/partialdiff/summation |
---|
346 | /product/pi/integral/ordfeminine/ordmasculine/Omega/ae/oslash |
---|
347 | /questiondown/exclamdown/logicalnot/radical/florin/approxequal/Delta/guillemotleft |
---|
348 | /guillemotright/ellipsis/blank/Agrave/Atilde/Otilde/OE/oe |
---|
349 | /endash/emdash/quotedblleft/quotedblright/quoteleft/quoteright/divide/lozenge |
---|
350 | /ydieresis/Ydieresis/fraction/currency/guilsinglleft/guilsinglright/fi/fl |
---|
351 | /daggerdbl/periodcentered/quotesinglbase/quotedblbase/perthousand/Acircumflex/Ecircumflex/Aacute |
---|
352 | /Edieresis/Egrave/Iacute/Icircumflex/Idieresis/Igrave/Oacute/Ocircumflex |
---|
353 | /apple/Ograve/Uacute/Ucircumflex/Ugrave/dotlessi/circumflex/tilde |
---|
354 | /macron/breve/dotaccent/ring/cedilla/hungarumlaut/ogonek/caron |
---|
355 | macvec 128 128 getinterval astore pop |
---|
356 | {}mark true/Courier/|______Courier 0 rf |
---|
357 | {/Metrics 21 dict begin/zero 600 def/one 600 def/two 600 def/three 600 def/four 600 def/five 600 def/six 600 def/seven 600 def/eight 600 def |
---|
358 | /nine 600 def/comma 600 def/period 600 def/dollar 600 def/numbersign 600 def/percent 600 def/plus 600 def/hyphen 600 def/E 600 def/parenleft 600 def/parenright 600 def/space 600 def |
---|
359 | currentdict end def currentdict/UniqueID known{/UniqueID 16#800000 def}if/FontBBox FontBBox 4 array astore def}mark true/Helvetica/|______Seattle 1 rf |
---|
360 | /oldsettransfer/settransfer load def |
---|
361 | /concatprocs{/proc2 exch cvlit def/proc1 exch cvlit def/newproc proc1 length proc2 length add array def |
---|
362 | newproc 0 proc1 putinterval newproc proc1 length proc2 putinterval newproc cvx}def |
---|
363 | /settransfer{currenttransfer concatprocs oldsettransfer}def |
---|
364 | /PaintBlack{{1 exch sub}settransfer gsave newpath clippath 1 setgray fill grestore}def |
---|
365 | /od{(Rvd\001\001\000\000\177) fg copy pop txpose |
---|
366 | 1 0 mtx defaultmatrix dtransform exch atan/pa exch def |
---|
367 | newpath clippath mark |
---|
368 | {transform{itransform moveto}}{transform{itransform lineto}} |
---|
369 | {6 -2 roll transform 6 -2 roll transform 6 -2 roll transform |
---|
370 | {itransform 6 2 roll itransform 6 2 roll itransform 6 2 roll curveto}} |
---|
371 | {{closepath}}pathforall newpath counttomark array astore/gc xdf pop ct 39 0 put |
---|
372 | 10 fz 0 fs 2 F/|______Courier fnt invertflag{PaintBlack}if}bdf |
---|
373 | /cd{}bdf |
---|
374 | /op{/sfl false def/pm save def}bdf |
---|
375 | /cp{not{userdict/#copies 0 put}if ma 0 gt{{t1 the{exit}if}loop}if{copypage}{showpage}ifelse pm restore}bdf |
---|
376 | /px{0 3 1 roll tp tt}bdf |
---|
377 | /psb{/us save def}bdf |
---|
378 | /pse{us restore}bdf |
---|
379 | /ct 40 string def |
---|
380 | /nc{currentpoint initclip newpath gc{dup type dup/arraytype eq exch/packedarraytype eq or{exec}if} |
---|
381 | forall clip newpath moveto}def |
---|
382 | /kp{ct 0 2 index length 2 index 39 2 index put getinterval copy cvx exec mx3 currentmatrix pop}bdf |
---|
383 | /av 68 def |
---|
384 | end |
---|
385 | LW 1 eq userdict/a4small known not and{/a4small |
---|
386 | [[300 72 div 0 0 -300 72 div -120 3381] |
---|
387 | 280 3255 |
---|
388 | {statusdict/jobstate (printing) put 0 setblink |
---|
389 | margins |
---|
390 | exch 196 add exch 304 add 8 div round cvi frametoroket |
---|
391 | statusdict/jobstate (busy) put |
---|
392 | 1 setblink} |
---|
393 | /framedevice load |
---|
394 | 60 45{dup mul exch dup mul add 1.0 exch sub}/setscreen load |
---|
395 | {}/settransfer load/initgraphics load/erasepage load]cvx |
---|
396 | statusdict begin bind end readonly def}if |
---|
397 | md begin/bigs[lnop userdict/letter known{/letter load}{lnop}ifelse userdict/legal known{/legal load}{lnop}ifelse userdict/a4 known{/a4 load}{lnop}ifelse userdict/b5 known{/b5 load}{lnop}ifelse |
---|
398 | lnop lnop lnop /tab load]def |
---|
399 | /smalls[lnop userdict/lettersmall known{/lettersmall load}{userdict/note known{/note load}{lnop}ifelse}ifelse |
---|
400 | userdict/legal known{/legal load}{lnop}ifelse userdict/a4small known{/a4small load}{lnop}ifelse |
---|
401 | userdict/b5 known{/b5 load}{userdict/note known{/note load}{lnop}ifelse}ifelse lnop lnop lnop /tab load]def end |
---|
402 | systemdict/currentpacking known{setpacking}if |
---|
403 | ok userdict/stretch known not and{currentfile eexec}{2928{currentfile read |
---|
404 | pop pop}repeat}ifelse |
---|
405 | 373A767D4B7FD94FE5903B7014B1B8D3BED02632C855D56F458B118ACF3AF73FC4EF5E81F5749042 |
---|
406 | B5F9CF1016D093B75F250B7D8280B2EACE05A37037F7BDF6E12226D7D4E2DF2C52FAFD5FD40FE72A |
---|
407 | 0D3AC4BD485D8369D4C87636E920D1DAF222D92155A9CB1667E715F0B82799B37CC8F5B32B74B39C |
---|
408 | F494536DC39C7EF04A7BCB29E2CEC79073CADCCFB23B4AA1363F876F5121B618071B7B4EB1E5DE75 |
---|
409 | FAA2368A3E5DB2B198623AFE92AE9484270FE7F57A850E88C0D3EEA156611C91D8E480D4370B025C |
---|
410 | CA6929A2BF40AD3D01B2CB7EE6DFB46E12A830542337F7819B67F9765210F76DB06F34DA5B13A117 |
---|
411 | 59305C582E16D2B854939F6D9121F2A4F285282F5DCD3D15896D121E3D6F5BE79E087451BB0ED233 |
---|
412 | CDBEF090D3B4AC2DC34B97E70C61D95FB072B8C12D2ABD843520949A39DCF99E2C1AA8FBCD025E47 |
---|
413 | E0A82A8D96E75BAF40F52AD402495BBD4DE0F356C8B14E764874E639C9F045A0D1908EC6456EB6C5 |
---|
414 | B8A6F826192F767EF2C55A21C58F5F9CC1F59247B55F2387828C7FE89D5E7D8484D1BC86CB6673BD |
---|
415 | BE4FE17DD9BDE95224FE645136F41330BF155A4DDE1B0A32233BF471CE58FBC660DC7E641B0A0D30 |
---|
416 | 018454E2191C414A3011FF3FED1C0D88FE1FF9F75DCC456D097947226FBEC92509146D3A4CFFC047 |
---|
417 | 1B31C53222ED9DD88566F60F6C0D705AD79DACF53B070026F083ED28B5CF757AAA0A169F6F320A75 |
---|
418 | E9D2ED50ABD939AF85B6346C2ADB25D168F10508E1516D194C635E6B187FADEA0829DBF0390C0F00 |
---|
419 | 3F0265E215BC96CA3CC13D4A8E01570BE193CA75A620728CD275ACF1986EFFB3A13419FE55EA7C44 |
---|
420 | 67B7E7EEDC1FC29C9F8C46A557D2CCDB914EF7B93E7530D555DFC2398AFC68CAD991F062EF85BAA1 |
---|
421 | 884EC166C7C5DF8543666D8C41BE267D706BD1588F1F662F705CAE4D29DC38EF66BFAA89470D8A09 |
---|
422 | 9B6F1B4587F7B024412276106FCD3EB5AE17A5D1DF1781992DC40EA0A992F706F701304CEA9D9073 |
---|
423 | E7A74F1E687D81C3E5841D31CF86855BAAAD9B5D30317C75150A857C6B114735315CDD1AEF36C26B |
---|
424 | BB0645499406DEE2F24B3B1C72FEC97C7BA31AA2CDAB25418BB1DC4C7E4757F1D625087B0FD0300C |
---|
425 | 03A65F2A72CE734925735277E034CDCF599129679F70CC8B66E03878851DB75041F275E1E5761F3E |
---|
426 | C753BE1359CA364A22047AE4886217F9259FE19FF5B116E8019B98B143114B313E8BEF87EC949D85 |
---|
427 | C82E0812E6F50525E73890AF362CC8EE8A85F4197E6AC18638EF12E56A808D439AF1BFD363F14031 |
---|
428 | 4BF4E534485C42F1856688CC35288E8D770120A420FB9F1FCF8AE8BD6D6156CC23E6C51119FE4DE1 |
---|
429 | B68C9DF3487E9974BF9ED31F8D3CE93FF101867319F2FF492D5D398B4F09A66F2F55BCAB34B99173 |
---|
430 | B7EE89039D00DD21A7B3A52E9F028F8301B5FC12D409412E064513BC579AAC498F577EA8ECD1FE3E |
---|
431 | 42DC3CC320786C7B00194FEDF344402C33FC492D4BA86992B01683F440220FFE756BC88A94223D31 |
---|
432 | 6078D69D33560E8EAB76B24CB7AA4320CF435593D76F624324ABE00B5587A4F283C725EA24567133 |
---|
433 | F25F472B5E2E4474DDB5A16AC5F2DF32350395D3E3892FE361F4D5C9A610C654C9227614FBBAFF33 |
---|
434 | 56A90A2266E00F66234061075491571A65616211257F160000000000000000000000000000000000 |
---|
435 | 000000000000000000000000000000 |
---|
436 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
437 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
438 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
439 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
440 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
441 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
442 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
443 | cleartomark |
---|
444 | ok userdict/smooth4 known not and{currentfile eexec}{5990{currentfile read |
---|
445 | pop pop}repeat}ifelse |
---|
446 | F94E00EE41A71C59E5CAEED1EDBCF23D1DBA1EE99B9BB356492923BD8B1BA83A87CEB0E07377A31F |
---|
447 | D6241E814681118E17DC7CACE570399506E6E441B871B6043831BD03EFC11DBBD8001EE2FF8CFBD4 |
---|
448 | 85065D455A2E15AC36F1A84AD8789FA6461199C7CD14CB9FD64D4B06452B7FC0A8FC263F70F1CCB8 |
---|
449 | 93295D4DE70ADAB771C0F84396FA98C60B11DA02ABA157298DF0A23621853BEF167443A985ADC09B |
---|
450 | EFFD51CB4D29179E2B34609EF38A49DA61F4BFC256A3DE0732D7D29754A194857B9C9E9971227AA1 |
---|
451 | DD0611FBB10E44E5FF66C062D9C24ED3290529330BC317825E876929582DB0E39B9FC5EFD20CC1D4 |
---|
452 | F94920EB9C534D0DA90DE70D25BC7287319CF28602B3F46633C242CAFC8905E960317E3C2FA20AB8 |
---|
453 | DB06ADBAF292FC7BA2CA14EE65DF28B99CC11666B70AD33E8E1D57D63D4B89ECC615AE5747C1CA75 |
---|
454 | 2C833D8D6DE54CD4A0350B44310555CE3BD2C615ADD27B634CDB350AF3A432CE78AACD2909A5B586 |
---|
455 | F666CD87919A36DB1CBE86B3CE281DFD01CD7E1B8A18A4B415CECBFF79A5C4390A15EA77D14D6BE1 |
---|
456 | 2BAB5A8268C3F286D0590060647CABED674443CD258F11415E866AB330A251691B61F2422A61AFE5 |
---|
457 | 9B6B4FBDCF85ED9BA0F8E483C034089E6877FF5923698D3A0DC0EED6B9CFD32DF0839BC4EA5F6D1F |
---|
458 | CB6DD0920391E57E84745131D02D100179F4E0A68EC0A5FF6680A6F463D038B04AF63FFA13D743B9 |
---|
459 | 95A26A743C26D387209023C91DE43DF047A16F328AC9DDC08573B38BE9EA341EA16C78EC32F3A1B3 |
---|
460 | 6B90D95A50610F4D050EC1C33497F3F3A81A1B4C8BEF0BA84EE2FAA32DC112DAC490AF53E1749C4A |
---|
461 | 0D866CAF7B893E52383B0D38065C333FB122B700D7246F7EE87D942AE3DB5C1DD77E9E76C80CC5AD |
---|
462 | 63D28DFED0E229CE604673F78CD47F258FDF5BF3A3EAEC5C9BC8E482D8DBA9D268A35DA8C095A690 |
---|
463 | 679ED2123E8B8F5E4826FA3B199EAA5D482D4B6AA86572E387CECEB7149C8947F41D6339328A748A |
---|
464 | 17F8C4AD3B0555F1E409450BA0C564F1F488BB5096EB003568D4D5EF6489897E27409547D0EE4487 |
---|
465 | D30184793B0F27BD265A64BDB3EA6761569DA955620C612E718677B77D6D81B999C6298877AFE0D1 |
---|
466 | D6F6F358377A8BD2402F669C64B972B3A065EF7DD4BDEFFFE17E63DB8898FA6E69166B710AAD6BA2 |
---|
467 | EA9AF61E4B8C8701638D4D6E4DFFFC192AEF6BC027095C4C72D748979675BA29FAF61E75343E14E6 |
---|
468 | 1034602E5A79CD2519796ED6A9CC4EDEA46A9B59D4A807E786B5EE46F25B0360BC8E7C12D723122C |
---|
469 | DEEF247C9776F4C99C8EBED6828AA19744B5ADF0D07D95D98B3072372388D41B0FAB1CCE27751706 |
---|
470 | 79575ECDCA13B22A17FE9C6605C3445F58F1A829512DAB6C528F83580C8AA53C35D605F626F5AD0B |
---|
471 | 7FC1EA87D69A835E3F53A1F450FB0AF42A5772F89D92A50D10F15BDBDA409F50C0B8AB93FE8A16D0 |
---|
472 | 29DD8BB5C480D1466735ED4D9CAF637E5ECD6C2ECB6BF3B3EFBEE7AB936D2C568E3009D156B87CAC |
---|
473 | B1FB3A48A70BC91B2EC35CC9147FFB1A524E2B2F2E4E2C1B12F1C1C63768BB95CD62FEC01CBA79B9 |
---|
474 | FA282DD4DF49990F27FF8EE4E2DDE2F0ACD83BC9D4BE0090192C7A799967EC4DC2D63C0835E22D4C |
---|
475 | 4B366D7FDCF3A05A4B53DF780F986EF25C79B665D5C00EFF7F17C0BB6D544F9D83A7FDAC47D9C568 |
---|
476 | 3A656011374253C918FF6EA64749DD971B2300DD5320033E01EC591F6318CCE94CE2B81C04322EC5 |
---|
477 | 2B624E50643B52391CCD2AB56396A2AD8E2D3CA61B80D9D4CC363B2DF7863526958CDF3497E36648 |
---|
478 | 406C317E58EC563E7C26149A2A3C643ADFB39A8DD92974C6D2A2A9D7B71CDF3FEBBF32BB02E7B45C |
---|
479 | F53AAEAD5E963A4AA4AF9A149A08A4EC303D5F2369977E93F54897EEAD31B06C5845D63F49D65F8E |
---|
480 | 5573962241A57CCD717CE6CA8C784A11192943616EA059B51BC38429E18D0121FCBB6FBD5D909B0D |
---|
481 | 89E616C66DEF6A0F165A7030BD911A1B120468329CBB006C8D37720E531CF31E878CB4AAAC137633 |
---|
482 | 675C3D546F5162487AB35F470C042BDEB945E0F2532BF92AA6FD53434440221ECD3533A7AA89900C |
---|
483 | B19EFE2CD872DF8B7969AF0D3B72BF31DC5DD69CA6460966F61AB17CB507964098DBA3AF122EEC31 |
---|
484 | 28A9BAFE1034493F372B36BD1351205E9043A67C544402D8BCE24358C8A5CE33867A00794CF7097D |
---|
485 | 59C88279A11EE9C854E7E7AAE881F9828C569D208F5F33375F59E9A3818CFA38AAD0CBFBA32F9F44 |
---|
486 | A8BB79DE4C40E3886457C16DA4A27953AA1E99472E35F2323F0BAA5E37DC28CBA46FEFB73B190016 |
---|
487 | 055ADD4D27615D748499A0E1C4B8C7EC339C1C4D95A813A85918A8D01EEB485DDCDCEA6EA3F2C2A9 |
---|
488 | D85C139CD90CCB352634F9AFE836BCAC0C274E352BA2071B5269D5DE4CCDE3FF990CBA974980C733 |
---|
489 | 2AE1545A9C60D5D1459D3AE95C1AC065733AF14FADB440A110DD539563B8D850CD0704C52F3F7CCC |
---|
490 | B53630D776560CBD22D8FF08F5B354487A171AEC15F5F54DE9CAB668BCAC573E788D92762EF63E76 |
---|
491 | 087005F4AC2D02E0CAC173C11BE62ACE5DC4D3374F2F9746C9981E125FF9AB8CAE76D13039E2C54D |
---|
492 | FD708E028A619EA1ED78E6B46F06DF0D0B74BBEDD8C190C7C0CEBDE8F7A4888CC36575313478DD2C |
---|
493 | FE392E9BB7B2416955D44B7024A3BA43FBF37293B386D64746D7748895411D243FAEC50638F2AA33 |
---|
494 | 337D7FA018ADDAC5835A0DDFAE99AD6299DFB4CA6872C59853E3AC12FC9E3D26629C5B49CF844C87 |
---|
495 | B3C4BFBE3074E3A1CE6984758C20C661084381CD6B4582D84F19C0000B5FC0DCB42B567E39603160 |
---|
496 | 1C095D7016283EBE5F13CD8A3A374A74DDBBABD36081149F8BC242085F2F7297CC97FD3B8BAD206D |
---|
497 | 8AC9707A39ECCC7963B522E08DA391A1EF12DD4D746DBDDDCC0834F88160CF189A9645567CEC2F02 |
---|
498 | 3A571AF0DFD15DB85B744C28C000DF53B05F8F210841F6E87A04F20C777B7C0BE6182BE2E90226E5 |
---|
499 | 301A12532A745F2FAAA81637CF11B78CD2B99A4D18B862D6C5DBD31793FB16A2D9AAD376D4484D75 |
---|
500 | AA833D0068B1D34DB74E3302480854E3B5484D8A47E39A89A2FA927BC3641EA7F8E004FDE4C2F08D |
---|
501 | 40D99F1ACB47CAF6887629BF6DFE12968D297596D28CE0CF148B12E7DCB49FB94F5ADBD214C3A6CE |
---|
502 | 1E249831BA9EB8A189F2CE1ABE39A7B537253E369A508A2AF2ADB9463F9B56BBBFF31D535FF997F5 |
---|
503 | 37C6675C196E7ECBD493F652FA7CC6D9C1CA3379BFDB5AF7513C6E834054494296B91A6EE8001143 |
---|
504 | 63D5D5D0759F41B4DECB653B9DE3E94583579EF549ED5F3FAFB12661ABC0C57A332406517ED3454E |
---|
505 | DED34B386C60F78DC976266E0EAF54FC245FB0E3EFC8016236436B599C1C97A8C5E0AC8F78361618 |
---|
506 | 73C71F01ED9CC25C236420F41FD8277993D3959205912FA0927B59E3DAE7377D82079447D6E41EE5 |
---|
507 | AEC0DFFF79AF8F4ED47F17EE708FEA45877860D56F8CBCE65A061E8E1CA4A5FBAF0E13429A7F0ADB |
---|
508 | 6F178FA449F46CC539BBC0107E3A53B1C362A04B20E6D721E7E6E1E4976A11DDC98C7614D22B53DF |
---|
509 | BB6DAE533AC9BE882021A735C30DAA4A44AED09F49A390E8CFF59BD9C30667AF21B03EC5CEBD5C2C |
---|
510 | 3AA2769E8D714191A48E7DDF50B13D1560E82EFB65FCE601AE9E8C351FBA1DED80B7351314E7F9F9 |
---|
511 | A784BFE3759B7E322A84E7B51F9DC5F5D9C8050CD79B27C0A4B0DD68A3C27A948AD6858E35B960D2 |
---|
512 | DEA838C479CAEA83B1A912174ACB2100E55E7A14892D7A9B3711FF0B20065C1995B49E1F23464A92 |
---|
513 | DD140642E3A7B1973849E64D1A3CF600000000000000000000000000000000000000000000000000 |
---|
514 | 00000000000000 |
---|
515 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
516 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
517 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
518 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
519 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
520 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
521 | 0000000000000000000000000000000000000000000000000000000000000000 |
---|
522 | cleartomark |
---|
523 | %%EndProcSet |
---|
524 | %%EndComments |
---|
525 | %%EndProlog |
---|
526 | %%BeginDocumentSetup |
---|
527 | md begin |
---|
528 | |
---|
529 | T T -31 -30 761 582 100 72 72 1 F F F F T T T psu |
---|
530 | (; document: GDE2.2)jn |
---|
531 | 0 mf |
---|
532 | od |
---|
533 | %%EndDocumentSetup |
---|
534 | %%Page: ? 1 |
---|
535 | op |
---|
536 | 31 30 xl |
---|
537 | 1 1 pen |
---|
538 | 753 90 gm |
---|
539 | (nc 31 30 761 582 6 rc)kp |
---|
540 | 1 setTxMode |
---|
541 | 0 fs |
---|
542 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
543 | 7 fz |
---|
544 | 2 F /|______Times-Roman fnt |
---|
545 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
546 | 753 303 gm |
---|
547 | 12 fz |
---|
548 | 2 F /|______Times-Roman fnt |
---|
549 | (1)show |
---|
550 | 86 90 gm |
---|
551 | 18 fz |
---|
552 | 2 F /|______Times-Roman fnt |
---|
553 | 0.25192 0. 32 0.02519 0.(Genetic Data Environment)awidthshow |
---|
554 | 86 306 gm |
---|
555 | 1.00982 0. 32 0.10098 0.(version 2.2)awidthshow |
---|
556 | 113 90 gm |
---|
557 | 14 fz |
---|
558 | 2 F /|______Times-Roman fnt |
---|
559 | 0.19348 0. 32 0.01934 0.(Table of Contents)awidthshow |
---|
560 | 125 90 gm |
---|
561 | 12 fz |
---|
562 | 2 F /|______Times-Roman fnt |
---|
563 | 0.87683 0.(Introduction.........................................................................................)ashow |
---|
564 | 125 148 gm |
---|
565 | ( )show |
---|
566 | 125 504 gm |
---|
567 | (2)show |
---|
568 | 137 90 gm |
---|
569 | -0.00367 0.(What's New for this Release)ashow |
---|
570 | 137 228 gm |
---|
571 | 1.01469 0.(.....................................................................)ashow |
---|
572 | 137 226 gm |
---|
573 | ( )show |
---|
574 | 137 504 gm |
---|
575 | (2)show |
---|
576 | 149 90 gm |
---|
577 | -0.10981 0.(System Requirements)ashow |
---|
578 | 149 196 gm |
---|
579 | 1.01313 0.(.............................................................................)ashow |
---|
580 | 149 193 gm |
---|
581 | ( )show |
---|
582 | 149 504 gm |
---|
583 | (2)show |
---|
584 | 161 90 gm |
---|
585 | -0.09104 0.(Note to Motif users)ashow |
---|
586 | 161 184 gm |
---|
587 | 1.01264 0.(................................................................................)ashow |
---|
588 | 161 182 gm |
---|
589 | ( )show |
---|
590 | 161 504 gm |
---|
591 | (2)show |
---|
592 | 173 90 gm |
---|
593 | -0.15522 0.(Installing the GDE)ashow |
---|
594 | 173 180 gm |
---|
595 | 1.01248 0.(.................................................................................)ashow |
---|
596 | 173 178 gm |
---|
597 | ( )show |
---|
598 | 173 504 gm |
---|
599 | (3)show |
---|
600 | 185 90 gm |
---|
601 | -0.08174 0.(Using the GDE)ashow |
---|
602 | 185 164 gm |
---|
603 | 1.01188 0.(.....................................................................................)ashow |
---|
604 | 185 163 gm |
---|
605 | ( )show |
---|
606 | 185 504 gm |
---|
607 | (3)show |
---|
608 | 197 90 gm |
---|
609 | -0.21920 0.(Data Types)ashow |
---|
610 | 197 144 gm |
---|
611 | 1.01121 0.(..........................................................................................)ashow |
---|
612 | 197 143 gm |
---|
613 | ( )show |
---|
614 | 197 504 gm |
---|
615 | (7)show |
---|
616 | 209 90 gm |
---|
617 | -0.10195 0.(Menu Functions)ashow |
---|
618 | 221 126 gm |
---|
619 | -0.16563 0.(File menu)ashow |
---|
620 | 221 176 gm |
---|
621 | 1.01232 0.(..................................................................................)ashow |
---|
622 | 221 173 gm |
---|
623 | ( )show |
---|
624 | 221 504 gm |
---|
625 | (7)show |
---|
626 | 233 126 gm |
---|
627 | -0.20724 0.(Edit menu)ashow |
---|
628 | 233 176 gm |
---|
629 | 1.01232 0.(..................................................................................)ashow |
---|
630 | 233 174 gm |
---|
631 | ( )show |
---|
632 | 233 504 gm |
---|
633 | (9)show |
---|
634 | 245 126 gm |
---|
635 | 7.54577 0. 32 0.75457 0.(DNA/RNA menu..........................................................................)awidthshow |
---|
636 | 245 208 gm |
---|
637 | ( )show |
---|
638 | 245 504 gm |
---|
639 | (9)show |
---|
640 | 257 90 gm |
---|
641 | -0.11619 0.(External Functions)ashow |
---|
642 | 257 180 gm |
---|
643 | 1.01248 0.(.................................................................................)ashow |
---|
644 | 257 179 gm |
---|
645 | ( )show |
---|
646 | 257 504 gm |
---|
647 | (10)show |
---|
648 | 269 90 gm |
---|
649 | -0.06219 0.(Bug reports/extensions)ashow |
---|
650 | 269 200 gm |
---|
651 | 1.01332 0.(............................................................................)ashow |
---|
652 | 269 199 gm |
---|
653 | ( )show |
---|
654 | 269 504 gm |
---|
655 | (12)show |
---|
656 | 281 90 gm |
---|
657 | -0.14102 0.(Acknowledgments)ashow |
---|
658 | 281 180 gm |
---|
659 | 1.01248 0.(.................................................................................)ashow |
---|
660 | 281 178 gm |
---|
661 | ( )show |
---|
662 | 281 504 gm |
---|
663 | (12)show |
---|
664 | 293 90 gm |
---|
665 | -0.08592 0.(Appendix A, File Formats)ashow |
---|
666 | 293 216 gm |
---|
667 | 1.01406 0.(........................................................................)ashow |
---|
668 | 293 214 gm |
---|
669 | ( )show |
---|
670 | 293 504 gm |
---|
671 | (13)show |
---|
672 | 305 90 gm |
---|
673 | -0.06129 0.(Appendix B, Adding Functions)ashow |
---|
674 | 305 240 gm |
---|
675 | 1.01536 0.(..................................................................)ashow |
---|
676 | 305 239 gm |
---|
677 | ( )show |
---|
678 | 305 504 gm |
---|
679 | (16)show |
---|
680 | 317 90 gm |
---|
681 | 5.07019 0. 32 0.50701 0.(Appendix C, External functions..................................................................)awidthshow |
---|
682 | 317 240 gm |
---|
683 | ( )show |
---|
684 | 317 504 gm |
---|
685 | (19)show |
---|
686 | F T cp |
---|
687 | %%Page: ? 2 |
---|
688 | op |
---|
689 | 31 30 xl |
---|
690 | 1 1 pen |
---|
691 | 753 90 gm |
---|
692 | (nc 31 30 761 582 6 rc)kp |
---|
693 | 1 setTxMode |
---|
694 | 0 fs |
---|
695 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
696 | 7 fz |
---|
697 | 2 F /|______Times-Roman fnt |
---|
698 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
699 | 753 303 gm |
---|
700 | 12 fz |
---|
701 | 2 F /|______Times-Roman fnt |
---|
702 | (2)show |
---|
703 | 99 90 gm |
---|
704 | 14 fz |
---|
705 | 2 F /|______Times-Roman fnt |
---|
706 | 0.16366 0.(Introduction)ashow |
---|
707 | 126 90 gm |
---|
708 | 10 fz |
---|
709 | 2 F /|______Times-Roman fnt |
---|
710 | -0.00480 0.(The Genetic Data Environment is part of a growing set of programs for manipulating and analyzing)ashow |
---|
711 | 137 90 gm |
---|
712 | -0.02925 0.("genetic" data. It differs in design from other analysis programs in that it is intended to be an expandable and)ashow |
---|
713 | 148 90 gm |
---|
714 | 0.30548 0. 32 0.03054 0.(customizable system, while still being easy to use.)awidthshow |
---|
715 | 170 90 gm |
---|
716 | -0.03929 0.(There are a tremendous number of publicly available programs for sequence analysis. Many of these)ashow |
---|
717 | 181 90 gm |
---|
718 | -0.02575 0.(programs have found their way into commercial packages which incorporate them into integrated, easy to use)ashow |
---|
719 | 192 90 gm |
---|
720 | 0.00381 0. 32 0.00038 0.(systems. The goal of the GDE is to minimize the amount of effort required to integrate sequence analysis)awidthshow |
---|
721 | 203 90 gm |
---|
722 | 0.02471 0. 32 0.00247 0.(functions into a common environment. The GDE takes care of the user interface issues, and allows the)awidthshow |
---|
723 | 214 90 gm |
---|
724 | 0.08422 0. 32 0.00842 0.(programmer to concentrate on the analysis itself. Existing programs can be tied into the GDE in a matter of)awidthshow |
---|
725 | 225 90 gm |
---|
726 | 0.05676 0. 32 0.00567 0.(hours \(or minutes\) as apposed to days or weeks. Programs may be written in any language, and still)awidthshow |
---|
727 | 236 90 gm |
---|
728 | -0.01551 0.(seamlessly be incorporated into the GDE.)ashow |
---|
729 | 258 90 gm |
---|
730 | 0.15960 0. 32 0.01596 0.(These programs are, and will continue to be, available at no charge. It is the hope that this system will)awidthshow |
---|
731 | 269 90 gm |
---|
732 | -0.00163 0.(grow in functionality as more and more people see the benefits of a modular analysis environment. Users)ashow |
---|
733 | 280 90 gm |
---|
734 | -0.04074 0.(are encouraged to make modifications to the system, and forward all changes and additions to Steven Smith)ashow |
---|
735 | 291 90 gm |
---|
736 | 0.55236 0. 32 0.05523 0.(at smith@bioimage.millipore.com.)awidthshow |
---|
737 | 316 90 gm |
---|
738 | 14 fz |
---|
739 | 2 F /|______Times-Roman fnt |
---|
740 | 0.33660 0. 32 0.03366 0.(What's New for this Release)awidthshow |
---|
741 | 339 90 gm |
---|
742 | 10 fz |
---|
743 | 2 F /|______Times-Roman fnt |
---|
744 | -0.01681 0.(GDE 2.2 represents a maintainence release. Several small bugs have been fixed, as well as new editing)ashow |
---|
745 | 350 90 gm |
---|
746 | -0.03550 0.(features and user interface elements. Also, I have tried to update all of the contributed external programs to)ashow |
---|
747 | 361 90 gm |
---|
748 | -0.07492 0.(their latest release. Updated programs include:)ashow |
---|
749 | 383 90 gm |
---|
750 | 0.17684 0.(Phylip)ashow |
---|
751 | 394 90 gm |
---|
752 | -0.12425 0.(Treetool)ashow |
---|
753 | 405 90 gm |
---|
754 | (LoopTool)show |
---|
755 | 416 90 gm |
---|
756 | -0.47906 0.(Readseq)ashow |
---|
757 | 427 90 gm |
---|
758 | -0.13854 0.(Blast)ashow |
---|
759 | 438 90 gm |
---|
760 | -0.02584 0.(Fasta)ashow |
---|
761 | 460 90 gm |
---|
762 | -0.03245 0.(Improved versions of printing, and translate are included as well. As for new editing features, a useful)ashow |
---|
763 | 471 90 gm |
---|
764 | -0.03184 0.("yanking" feature has been added by Scott Ferguson from Exxon Research, and the capability to export the)ashow |
---|
765 | 482 90 gm |
---|
766 | -0.03855 0.(colormap for a seqeunce \(see appendicies A/C\). Among the bugs fixed in this release are:)ashow |
---|
767 | 504 90 gm |
---|
768 | 0.04196 0. 32 0.00419 0.(Selection mask problems when exporting to Genbank \(fixed in 2.1\))awidthshow |
---|
769 | 515 90 gm |
---|
770 | -0.01756 0.(Memory leaks \(fixed in 2.1\))ashow |
---|
771 | 526 90 gm |
---|
772 | -0.11788 0.(Correct handling of circular sequences)ashow |
---|
773 | 537 90 gm |
---|
774 | -0.05303 0.(More liberal interpretation of Genbank formatted files. \(not column dependent\))ashow |
---|
775 | 573 90 gm |
---|
776 | 14 fz |
---|
777 | 2 F /|______Times-Roman fnt |
---|
778 | -0.02626 0.(System Requirements)ashow |
---|
779 | 596 90 gm |
---|
780 | 10 fz |
---|
781 | 2 F /|______Times-Roman fnt |
---|
782 | 0.16036 0. 32 0.01603 0.(GDE 2.2 currently runs on the Sun family of workstations. This includes the Sun3 and Sun4 \(Sparcstation\))awidthshow |
---|
783 | 607 90 gm |
---|
784 | 0.19104 0. 32 0.01910 0.(systems. It was written in XView, and runs on Suns using OpenWindows 3.0 or MIT's X Windows. It)awidthshow |
---|
785 | 618 90 gm |
---|
786 | 0.00488 0. 32 0.00048 0.(runs in both monochrome, and color, and can be run remotely on any system capable of running X Windows)awidthshow |
---|
787 | 629 90 gm |
---|
788 | -0.01159 0.(Release 4. You should have at least 15 meg of free disk space available. The binay release for)ashow |
---|
789 | 640 90 gm |
---|
790 | (SparcStations was compiled under SunOS 4.1.2 and Openwindows 3.0.)show |
---|
791 | 662 90 gm |
---|
792 | 0.14724 0. 32 0.01472 0.(We are also supporting a DECStation version of GDE. This is running under XView 3.0/X11R5. We)awidthshow |
---|
793 | 673 90 gm |
---|
794 | -0.00736 0.(encourage interested people to port the programs to their favorite Unix platform. There are informal ports to)ashow |
---|
795 | 684 90 gm |
---|
796 | 0.22964 0. 32 0.02296 0.(the SGI line of unix machines.)awidthshow |
---|
797 | 709 90 gm |
---|
798 | 14 fz |
---|
799 | 2 F /|______Times-Roman fnt |
---|
800 | 0.36575 0. 32 0.03657 0.(Note to Motif users)awidthshow |
---|
801 | F T cp |
---|
802 | %%Page: ? 3 |
---|
803 | op |
---|
804 | 31 30 xl |
---|
805 | 1 1 pen |
---|
806 | 753 90 gm |
---|
807 | (nc 31 30 761 582 6 rc)kp |
---|
808 | 1 setTxMode |
---|
809 | 0 fs |
---|
810 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
811 | 7 fz |
---|
812 | 2 F /|______Times-Roman fnt |
---|
813 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
814 | 753 303 gm |
---|
815 | 12 fz |
---|
816 | 2 F /|______Times-Roman fnt |
---|
817 | (3)show |
---|
818 | 92 90 gm |
---|
819 | 10 fz |
---|
820 | 2 F /|______Times-Roman fnt |
---|
821 | 0.08575 0. 32 0.00857 0.(GDE2.2 can be run using different window managers. The most common alternative to olwm is the Motif)awidthshow |
---|
822 | 103 90 gm |
---|
823 | 0.12878 0. 32 0.01287 0.(window manager \(mwm\). The only problem in using another window manager is that the status line is not)awidthshow |
---|
824 | 114 90 gm |
---|
825 | -0.04948 0.(displayed. We have added a "Message panel" as an option under "File->Properties" which displays all of the)ashow |
---|
826 | 125 90 gm |
---|
827 | 0.10406 0. 32 0.01040 0.(information contained on the status line.)awidthshow |
---|
828 | 147 90 gm |
---|
829 | -0.03054 0.(People using other window managers may also prefer using xterm, and xedit as default terminals and file)ashow |
---|
830 | 158 90 gm |
---|
831 | -0.02236 0.(editors. This can be accomplished by replacing all occurrences of 'shelltool' and 'textedit' with 'xterm -e' and)ashow |
---|
832 | 169 90 gm |
---|
833 | 0.10833 0. 32 0.01083 0.('xedit' in the $GDE_HELP_DIR/.GDEmenus file.)awidthshow |
---|
834 | 205 90 gm |
---|
835 | 14 fz |
---|
836 | 2 F /|______Times-Roman fnt |
---|
837 | 0.33935 0. 32 0.03393 0.(Installing the GDE)awidthshow |
---|
838 | 228 90 gm |
---|
839 | 10 fz |
---|
840 | 2 F /|______Times-Roman fnt |
---|
841 | -0.03640 0.(Instructions for the source code release are included in the README.install file.)ashow |
---|
842 | 250 90 gm |
---|
843 | -0.00282 0.(The binary installations consist of creating a GDE directory, such as /usr/local/GDE, and un-taring the)ashow |
---|
844 | 261 90 gm |
---|
845 | 0.15594 0. 32 0.01559 0.(installation tarfile into the directory. If you are installing the GDE for your own use, then you can simply)awidthshow |
---|
846 | 272 90 gm |
---|
847 | 0.01647 0. 32 0.00164 0.(make a GDE subdirectory. There is no need to be superuser \(root\) to do the installation in your own)awidthshow |
---|
848 | 283 90 gm |
---|
849 | -0.02723 0.(directory. For example:)ashow |
---|
850 | 302 90 gm |
---|
851 | {}mark T /Courier /|______Courier 0 rf |
---|
852 | 7 fz |
---|
853 | 2 F /|______Courier fnt |
---|
854 | 2.13836 0. 32 0.21383 0.(demo% )awidthshow |
---|
855 | 1 fs |
---|
856 | {}mark T /Courier-Bold /|______Courier-Bold 0 rf |
---|
857 | 2 F /|______Courier-Bold fnt |
---|
858 | 3.93264 0. 32 0.39326 0.(mkdir /usr/local/GDE)awidthshow |
---|
859 | 310 90 gm |
---|
860 | 0 fs |
---|
861 | 2 F /|______Courier fnt |
---|
862 | 2.34207 0. 32 0.23420 0.(demo% )awidthshow |
---|
863 | 1 fs |
---|
864 | 2 F /|______Courier-Bold fnt |
---|
865 | 3.72085 0. 32 0.37208 0.(cp GDE2.2.tar /usr/local/GDE)awidthshow |
---|
866 | 318 90 gm |
---|
867 | 0 fs |
---|
868 | 2 F /|______Courier fnt |
---|
869 | 2.02575 0. 32 0.20257 0.(demo% )awidthshow |
---|
870 | 1 fs |
---|
871 | 2 F /|______Courier-Bold fnt |
---|
872 | 3.53195 0. 32 0.35319 0.(cd /usr/local/GDE)awidthshow |
---|
873 | 326 90 gm |
---|
874 | 0 fs |
---|
875 | 2 F /|______Courier fnt |
---|
876 | 2.06634 0. 32 0.20663 0.(demo% )awidthshow |
---|
877 | 1 fs |
---|
878 | 2 F /|______Courier-Bold fnt |
---|
879 | 2.68066 0. 32 0.26806 0.(tar -xf GDE2.2.tar)awidthshow |
---|
880 | 348 90 gm |
---|
881 | 0 fs |
---|
882 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
883 | 10 fz |
---|
884 | 2 F /|______Times-Roman fnt |
---|
885 | -0.00643 0.(After this, each new user will need to add two lines to their .cshrc file so that they can find the gde programs)ashow |
---|
886 | 359 90 gm |
---|
887 | -0.07226 0.(and files.)ashow |
---|
888 | 378 90 gm |
---|
889 | {}mark T /Courier /|______Courier 0 rf |
---|
890 | 7 fz |
---|
891 | 2 F /|______Courier fnt |
---|
892 | 1.93252 0. 32 0.19325 0.(demo% )awidthshow |
---|
893 | 1 fs |
---|
894 | {}mark T /Courier-Bold /|______Courier-Bold 0 rf |
---|
895 | 2 F /|______Courier-Bold fnt |
---|
896 | 2.27355 0. 32 0.22735 0.(cat >> ~/.cshrc)awidthshow |
---|
897 | 386 90 gm |
---|
898 | 3.89968 0. 32 0.38996 0.(set path = \($path /usr/local/GDE/bin\))awidthshow |
---|
899 | 394 90 gm |
---|
900 | 5.43060 0. 32 0.54306 0.(setenv GDE_HELP_DIR /usr/local/GDE/help/)awidthshow |
---|
901 | 402 90 gm |
---|
902 | 1.60203 0.(^D)ashow |
---|
903 | 421 90 gm |
---|
904 | 0 fs |
---|
905 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
906 | 10 fz |
---|
907 | 2 F /|______Times-Roman fnt |
---|
908 | 0.06118 0. 32 0.00611 0.(You may wish to make a copy of the .GDEmenus file from the help directory into your home directory.)awidthshow |
---|
909 | 432 90 gm |
---|
910 | 0.13107 0. 32 0.01310 0.(This is only necessary if you wish to modify your menus. Copy the demo files from /usr/local/GDE/demo)awidthshow |
---|
911 | 443 90 gm |
---|
912 | -0.02130 0.(into your local directory, and you are now ready to use the GDE.)ashow |
---|
913 | 465 90 gm |
---|
914 | -0.05734 0.(FastA and Blast need to have the properly formatted databases installed in the $GDE_HELP_DIR under the)ashow |
---|
915 | 476 90 gm |
---|
916 | 0.15838 0. 32 0.01583 0.(directories FASTA/PIR, FASTA/GENBANK, BLAST/pir BLAST/genbank. For FASTA, simply copy a)awidthshow |
---|
917 | 487 90 gm |
---|
918 | -0.01397 0.(version of PIR and Genbank into the proper directory. Alternately, the PIR and GENBANK files can be)ashow |
---|
919 | 498 90 gm |
---|
920 | 0.11154 0. 32 0.01115 0.(symbolic links to copies of Genbank held elsewhere on your system. You may need to look at the)awidthshow |
---|
921 | 509 90 gm |
---|
922 | 0.04348 0. 32 0.00434 0.(.GDEmenus file in $GDE_HELP_DIR to verify that you are using the same divisions for these databases.)awidthshow |
---|
923 | 531 90 gm |
---|
924 | 0.01754 0. 32 0.00175 0.(Blast installation involves converting PIR and GENBANK to a temporary FASTA format \(using pir2fasta)awidthshow |
---|
925 | 542 90 gm |
---|
926 | -0.07652 0.(and gb2fasta\) and then using pressdb for nucleic acid, and setdb for amino acid to reformat the databases again)ashow |
---|
927 | 553 90 gm |
---|
928 | 0.23468 0. 32 0.02346 0.(into blast format. The .GDEmenus file is currently set up to search with blast using the following)awidthshow |
---|
929 | 564 90 gm |
---|
930 | 0.01464 0. 32 0.00146 0.(databases: pir, genpept, genupdate, and genbank. If you wish to divide these into subdivisions, then the)awidthshow |
---|
931 | 575 90 gm |
---|
932 | -0.00154 0.(.GDEmenus file will have to be edited.)ashow |
---|
933 | 597 90 gm |
---|
934 | 0.18249 0. 32 0.01824 0.(The most up to date release of blast can be obtained via anonymous ftp to ncbi.nlm.nih.gov. The most)awidthshow |
---|
935 | 608 90 gm |
---|
936 | 0.00610 0. 32 0.00061 0.(recent release of FASTA can be obtained via anonymous ftp to uvaarpa.virginia.edu. It is strongly)awidthshow |
---|
937 | 619 90 gm |
---|
938 | -0.03916 0.(recommended that you retrieve these copies, and become familiar with their setup.)ashow |
---|
939 | 644 90 gm |
---|
940 | 14 fz |
---|
941 | 2 F /|______Times-Roman fnt |
---|
942 | 0.21560 0. 32 0.02156 0.(Using the GDE)awidthshow |
---|
943 | 667 90 gm |
---|
944 | 10 fz |
---|
945 | 2 F /|______Times-Roman fnt |
---|
946 | 0.08346 0. 32 0.00834 0.(It is assumed that the user is familiar with the Unix, and OpenWindows/Xwindows environments. It is also)awidthshow |
---|
947 | 678 90 gm |
---|
948 | -0.04437 0.(assumed that people running standard MIT X-Windows will be using the OpenLook window manager)ashow |
---|
949 | 689 90 gm |
---|
950 | 0.03479 0. 32 0.00347 0.(\(olwm\). Other window managers work with varied success. If you are not certain as to how your system is)awidthshow |
---|
951 | 700 90 gm |
---|
952 | 0.06744 0. 32 0.00674 0.(set up, please contact your systems administrator.)awidthshow |
---|
953 | F T cp |
---|
954 | %%Page: ? 4 |
---|
955 | op |
---|
956 | 31 30 xl |
---|
957 | 1 1 pen |
---|
958 | 753 90 gm |
---|
959 | (nc 31 30 761 582 6 rc)kp |
---|
960 | 1 setTxMode |
---|
961 | 0 fs |
---|
962 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
963 | 7 fz |
---|
964 | 2 F /|______Times-Roman fnt |
---|
965 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
966 | 753 303 gm |
---|
967 | 12 fz |
---|
968 | 2 F /|______Times-Roman fnt |
---|
969 | (4)show |
---|
970 | 81 90 gm |
---|
971 | 10 fz |
---|
972 | 2 F /|______Times-Roman fnt |
---|
973 | -0.00114 0.(Once the window system has started, and a terminal window \(xterm, shelltool etc.\) you can start up the GDE)ashow |
---|
974 | 92 90 gm |
---|
975 | 0.61325 0. 32 0.06132 0.(by typing:)awidthshow |
---|
976 | 114 90 gm |
---|
977 | 1.45217 0. 32 0.14521 0.(demo% )awidthshow |
---|
978 | 1 fs |
---|
979 | {}mark T /Times-Bold /|______Times-Bold 0 rf |
---|
980 | 2 F /|______Times-Bold fnt |
---|
981 | 1.81137 0. 32 0.18113 0.(gde tRNAs)awidthshow |
---|
982 | 136 90 gm |
---|
983 | 0 fs |
---|
984 | 2 F /|______Times-Roman fnt |
---|
985 | -0.00747 0.(This should load the sample data set tRNAs into GDE, and the following window should appear:)ashow |
---|
986 | 0 0 gm |
---|
987 | (nc 138 90 335 544 6 rc)kp |
---|
988 | 64 gr |
---|
989 | 178 136 309 419 1 rc |
---|
990 | T 283 8.72726 136 178 98 778 24 T 1 db |
---|
991 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
992 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
993 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
994 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
995 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
996 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
997 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
998 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
999 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1000 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1001 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1002 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1003 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1004 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1005 | 00001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0000000000000000000 |
---|
1006 | 00003FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0040000000000000000 |
---|
1007 | 0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1008 | 0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040040000000000000000 |
---|
1009 | 000FE7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFCFC40000000000000000 |
---|
1010 | 0008000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1011 | 0008000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1012 | 0008000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1013 | 0008000004000000000000000000000000000000000000000000000000000000000000000000000000600000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1014 | 0008003F84000000000000000000000000000000000000000000000000000000000000001E0000000860007C0010000FC000060000000000000100000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1015 | 0078003F040000000000000000000000000000000000000000000000000000000000000033000000180000660030000C00000000000000000003000000000000000000000000000000000000000000000000000000000000003C0000000000000000 |
---|
1016 | 00C0001E0400000000000000000000000000000000000000000000000000000000000000601E1B0F3E63C0631E7CF00C0D8CC66CF0D86CC3C367C00000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1017 | 00C0001E040000000000000000000000000000000000000000000000000000000000000060331D99986660633331980C0ECCC66D98EC776663B3000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1018 | 00C0000C040000000000000000000000000000000000000000000000000000000000000060331999986600630330180F8CCCC67198CC66666333000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1019 | T 283 8 136 186.69564 98 778 23 T 1 db |
---|
1020 | 0078003F040000000000000000000000000000000000000000000000000000000000000033000000180000660030000C00000000000000000003000000000000000000000000000000000000000000000000000000000000003C0000000000000000 |
---|
1021 | 00C0001E0400000000000000000000000000000000000000000000000000000000000000601E1B0F3E63C0631E7CF00C0D8CC66CF0D86CC3C367C00000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1022 | 00C0001E040000000000000000000000000000000000000000000000000000000000000060331D99986660633331980C0ECCC66D98EC776663B3000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1023 | 00C0000C040000000000000000000000000000000000000000000000000000000000000060331999986600630330180F8CCCC67198CC66666333000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1024 | 00C0000C0400000000000000000000000000000000000000000000000000000000000000633F199F986600631F30F80C0CC6866198CC6667E333000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1025 | 00C00000040000000000000000000000000000000000000000000000000000000000000063301998186600633331980C0CC6866198CC66660333000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1026 | 00C00000040000000000000000000000000000000000000000000000000000000000000033311998986620663331980C0CC3066198CC66662333000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1027 | 00C0000004000000000000000000000000000000000000000000000000000000000000001F1E198F0E63C07C1D9CEC0FCCC30660F0CC6663C331C00000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1028 | 00C00000040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1029 | 00C001FFF80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1030 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1031 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1032 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1033 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000008C0000000000000000 |
---|
1034 | 00C3FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8C0000000000000000 |
---|
1035 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1036 | 00C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8C0000000000000000 |
---|
1037 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1038 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1039 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1040 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1041 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1042 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1043 | 00C00000110000001000000002200000080000000000004000000000020000000000000200000010000000000000000000400000000000040000000200000000000400000800000000000000000000000000000000000000000C0000000000000000 |
---|
1044 | 00C0000F110000000800003E022200000400001F0421804F0843000001000003C00020020000000800003E004000000000200000F800400400000004F8007800000200000400000000000000000000000000000000000000000C0000000000000000 |
---|
1045 | 00C0000801000000080000200202000004000010862180888C430000010000022000200000000008000020004000000000200000840040040000000480008400000200000400000000000000000000000000000000000000000C0000000000000000 |
---|
1046 | 00C00008111C01FC040000201E2780FE02000010462240888C44803F80800002258C79C22C01FC0400002044F59C3807F01000008238F385870E380880890070B0E100FE0200000000000000000000000000000000000000000C0000000000000000 |
---|
1047 | T 283 8 136 194.72726 98 778 22 T 1 db |
---|
1048 | 00C00000110000001000000002200000080000000000004000000000020000000000000200000010000000000000000000400000000000040000000200000000000400000800000000000000000000000000000000000000000C0000000000000000 |
---|
1049 | 00C0000F110000000800003E022200000400001F0421804F0843000001000003C00020020000000800003E004000000000200000F800400400000004F8007800000200000400000000000000000000000000000000000000000C0000000000000000 |
---|
1050 | 00C0000801000000080000200202000004000010862180888C430000010000022000200000000008000020004000000000200000840040040000000480008400000200000400000000000000000000000000000000000000000C0000000000000000 |
---|
1051 | 00C00008111C01FC040000201E2780FE02000010462240888C44803F80800002258C79C22C01FC0400002044F59C3807F01000008238F385870E380880890070B0E100FE0200000000000000000000000000000000000000000C0000000000000000 |
---|
1052 | 00C00008112201F804000020222200FC02000010452241088A44803F00800002261222223201F8040000204446224007E0100000824444464890440880890088C91100FC0200000000000000000000000000000000000000000C0000000000000000 |
---|
1053 | 00C0000F112200F00400003C222200780200001045A2410F0B44801E00800002242122222200F00400003C2844024003C01000008204404440904408F0890088891100780200000000000000000000000000000000000000000C0000000000000000 |
---|
1054 | 00C00008113E00F004000020222200780200001044A7E109094FC01E00800003C42123E22200F00400002010441E3003C0100000823C43C4478C7C08808904F889F100780200000000000000000000000000000000000000000C0000000000000000 |
---|
1055 | 00C00008112000600400002022220030020000104464220888C8400C008000020421220222006004000020284422080180100000824444444882400880890480890100300200000000000000000000000000000000000000000C0000000000000000 |
---|
1056 | 00C00008112200600400002026220030020000108464220888C8400C008000020412222222006004000020444422080180100000844444444882440480988488891200300200000000000000000000000000000000000000000C0000000000000000 |
---|
1057 | 00C00008111C00000400003E1A2180000200001F042424088848400000800002040C19C22200000400003E44341D700000100000F83A33A7875C3804F8687C7088E200000200000000000000000000000000000000000000000C0000000000000000 |
---|
1058 | 00C00000000000000800000000000000040000000000040000000000010000000000000000000008000000000000000000200000000000000000000200000000000400000400000000000000000000000000000000000000000C0000000000000000 |
---|
1059 | 00C00000000000000800000000000000040000000000000000000000010000000000000000000008000000000000000000200000000000000000000000000000000000000400000000000000000000000000000000000000000C0000000000000000 |
---|
1060 | 00C00000000000001000000000000000080000000000000000000000020000000000000000000010000000000000000000400000000000000000000000000000000000000800000000000000000000000000000000000000000C0000000000000000 |
---|
1061 | 00C00800000000002000100000000000100008000000000000000000040002000000000000000020001000000000000000800040000000000000000000000000000000001000000000000000000000000000000000000000000C0000000000000000 |
---|
1062 | 00C0060000000000C0000C00000000006000060000000000000000001800018000000000000000C0000C00000000000003000030000000000000000000000000000000006000000000000000000000000000000000000000000C0000000000000000 |
---|
1063 | 00C001FFFFFFFFFF000003FFFFFFFFFF800001FFFFFFFFFFFFFFFFFFE000007FFFFFFFFFFFFFFF000003FFFFFFFFFFFFFC00000FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000000000000000000000000000000000000000000C0000000000000000 |
---|
1064 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1065 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1066 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1067 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1068 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1069 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1070 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1071 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1072 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1073 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1074 | T 283 8 136 202.69564 98 778 23 T 1 db |
---|
1075 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1076 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1077 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1078 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1079 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1080 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1081 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1082 | 00C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC00040C0000000000000000 |
---|
1083 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1084 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1085 | 00C40000000000000000000000000000000000003FE0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1086 | 00C40000000000000000000000000000000000003FE0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1087 | 00C4031C0C08F8000000000000000000000000003E23870E1C3877F1C3860E1C3070E1DFC70EFE3070EFE3877F1C3870E1DFC70CFE3060E1C3870C183867F1C3BF8E1C3BFFF1C3060CFE3870E1C3870E1C3870E183070C7FFC0C0000000000000000 |
---|
1088 | 00C40312121808000000000000000000000000003DA489122448908244861224309122420912103091210489082448912242090C1030612244890C184860824484122448408243060C104891224489122448912183091400000C0000000000000000 |
---|
1089 | 00C40491212808000000000000000000000000003BE8102040810084080920404902040210201049020108100840810204021012104892040810122480908408042040804084048912108102040810204081020244902400000C0000000000000000 |
---|
1090 | 00C40491214810000000000000000000000000003BE8102040810084080920404902040210201049020108100840810204021012104892040810122480908408042040804084048912108102040810204081020244902400000C0000000000000000 |
---|
1091 | 00C40491218820000000000000000000000000003BE8102040810084080920404902040210201049020108100840810204021012104892040810122480908408042040804084048912108102040810204081020244902400040C0000000000000000 |
---|
1092 | 00C40FD121FC20000000000000000000000000003BE8902244891084489FA240FD120402112210FD12010811084089122402103F10FDFA0408113F7E89F884088420448840840FDFBF1081022448102040811207EFD02400040C0000000000000000 |
---|
1093 | 00C40851210840000000000000000000000000003BE89022448910844890A240851204021122108512010811084089122402102110850A0408112142890884088420448840840850A1108102244810204081120428502400040C0000000000000000 |
---|
1094 | 00C40852120840000000000000000000000000003DE48812244890824490922084910202091210849101040908204891220208211085090204092142490882048410244840820850A1104081224408102040910428481400040C0000000000000000 |
---|
1095 | 00C4085C0C0840000000000000000000000000003E23870E1C387081C3908E1C8470E1C2070E108470E10387081C3870E1C20721108508E1C3872142390881C3840E1C384081C850A1103870E1C3870E1C3870E428470C03040C0000000000000000 |
---|
1096 | 00C40000000000000000000000000000000000003FE0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000407840C0000000000000000 |
---|
1097 | 00C40000000000000000000000000000000000003FE000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040FC40C0000000000000000 |
---|
1098 | 00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000 |
---|
1099 | 00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000 |
---|
1100 | 00C403882242000000000000000000000000000031C3870E1C3067F183877F1C3077FFE3877F183860E1C3070E183877FFE3870E183070EFE3870E1C3BF8E1C3870C1DFFF8E1C3077F1DFC70EFFFFF8E1C3870EFE3870C00040C0000000000000000 |
---|
1101 | 00C40488224200000000000000000000000000003244891224306081848908243090810489081848612243091218489081048912183091210489122448412244890C24204122430908242091210204122448912104890C00040C0000000000000000 |
---|
1102 | T 283 8 136 210.72726 98 778 22 T 1 db |
---|
1103 | 00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000 |
---|
1104 | 00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000 |
---|
1105 | 00C403882242000000000000000000000000000031C3870E1C3067F183877F1C3077FFE3877F183860E1C3070E183877FFE3870E183070EFE3870E1C3BF8E1C3870C1DFFF8E1C3077F1DFC70EFFFFF8E1C3870EFE3870C00040C0000000000000000 |
---|
1106 | 00C40488224200000000000000000000000000003244891224306081848908243090810489081848612243091218489081048912183091210489122448412244890C24204122430908242091210204122448912104890C00040C0000000000000000 |
---|
1107 | 00C40808225A00000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101400040C0000000000000000 |
---|
1108 | 00C40808145A00000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101400040C0000000000000000 |
---|
1109 | 00C40808145A00000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101400040C0000000000000000 |
---|
1110 | 00C40888082400000000000000000000000000003448112244FDF887E8900840FD10810891087E89FA240FD0227E8100810890207EFD12210811224488420448113F442042044FD108402102210204204081120108103C00040C0000000000000000 |
---|
1111 | 00C408880824000000000000000000000000000034481122448508842890084085108108910842890A2408502242810081089020428512210811224488420448112144204204485108402102210204204081120108102400040C0000000000000000 |
---|
1112 | 00C40488082400000000000000000000000000003244091224850884248808208490810489084249092208481242408081048810428491210409122448410244092124204102484908202081210204102040910104082400040C0000000000000000 |
---|
1113 | 00C4038F0824000000000000000000000000000031C3870E1C8508842387081C847081038708423908E1C8470E4238708103870E428470E103870E1C3840E1C387211C2040E1C847081C2070E102040E1C3870E103872400040C0000000000000000 |
---|
1114 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1115 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1116 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1117 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1118 | 00C41FC70E18780000000000000000000000000031833FFF1C3870E1C3877FFE3060E183060E1C3877FFE33F8EFE3070E1C3867FFE3BF8C1833F8E1C3BF8EFE3077F1C3870EFFFC70E183BF8E1C3870C183870E1C3877C00040C0000000000000000 |
---|
1119 | 00C40209121880000000000000000000000000003183040824489122448908103061218306122448908103041210309122448608104840C183041224484121030908244891210209121848412244890C1848912244890C00040C0000000000000000 |
---|
1120 | 00C40210202480000000000000000000000000003244840840810204081008104892024489204081008104842010490204080908108041224484204080420104900840810201021020248042040810122481020408100C00040C0000000000000000 |
---|
1121 | 00C402102024C0000000000000000000000000003244840840810204081008104892024489204081008104842010490204080908108041224484204080420104900840810201021020248042040810122481020408100C00040C0000000000000000 |
---|
1122 | 00C40210202470000000000000000000000000003244840840810204081008104892024489204081008104842010490204080908108041224484204080420104900840810201021020248042040810122481020408100C00040C0000000000000000 |
---|
1123 | 00C40211207E180000000000000000000000000037EFC4084089120448110810FDFA07EFDFA2408910810FC42210FD1204489F88108043F7EFC420408842010FD108408112210210227E80420408913F7E81120448100C00040C0000000000000000 |
---|
1124 | 00C4021120420800000000000000000000000000342844084089120448110810850A042850A24089108108442210851204489088108042142844204088420108510840811221021022428042040891214281120448100C00040C0000000000000000 |
---|
1125 | 00C40209104208000000000000000000000000003428440820489102440908108509042850922048908108441210849102449088104042142844102048410108490820409121020812424041020489214240910244080C7FFC0C0000000000000000 |
---|
1126 | 00C402070E42F000000000000000000000000000342844081C3870E1C38708108508E428508E1C38708108440E108470E1C390881038421428440E1C3840E10847081C3870E102070E423840E1C38721423870E1C3870C00040C0000000000000000 |
---|
1127 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1128 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1129 | T 283 8 136 218.69564 98 778 23 T 1 db |
---|
1130 | 00C40209104208000000000000000000000000003428440820489102440908108509042850922048908108441210849102449088104042142844102048410108490820409121020812424041020489214240910244080C7FFC0C0000000000000000 |
---|
1131 | 00C402070E42F000000000000000000000000000342844081C3870E1C38708108508E428508E1C38708108440E108470E1C390881038421428440E1C3840E10847081C3870E102070E423840E1C38721423870E1C3870C00040C0000000000000000 |
---|
1132 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1133 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1134 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1135 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1136 | 00C41FC71E18780000000000000000000000000031833FFF1C3870E1C3870CFE3070EFE3860EFE3870EFE3070C1C3860E1C3870CFFFC77F183067F1C3870E1DFC77F1C3BFFF1C3BFFF1C3867FFE3870E183BF8E1C3870C1FE40C0000000000000000 |
---|
1137 | 00C4020910188000000000000000000000000000318304082448912244890C103091210486121048912103090C2448612244890C10209081830608244891224209082448408244840824486081048912184841224489141FE40C0000000000000000 |
---|
1138 | 00C4021010248000000000000000000000000000324484084081020408101210490201080920108102010490124080920408101210210082448908408102040210084080408408040840809081081020248042040810240FC40C0000000000000000 |
---|
1139 | 00C402101024C0000000000000000000000000003244840840810204081012104902010809201081020104901240809204081012102100824489084081020402100840804084080408408090810810202480420408102407840C0000000000000000 |
---|
1140 | 00C402101E2470000000000000000000000000003244840840810204081012104902010809201081020104901240809204081012102100824489084081020402100840804084080408408090810810202480420408102403040C0000000000000000 |
---|
1141 | 00C40211107E180000000000000000000000000037EFC4084089020408913F10FD1201081FA2108112210FD13F4481FA2448913F10210087EFDF8840810204421108408040844884084089F8810810227E88420408912400040C0000000000000000 |
---|
1142 | 00C40211104208000000000000000000000000003428440840890204089121108512010810A21081122108512144810A24489121102100842850884081020442110840804084488408408908810810224288420408912400040C0000000000000000 |
---|
1143 | 00C40209104208000000000000000000000000003428440820488102048921108491010410921040912108492124410922448921102080842850882040810242090820404082448408204908810408124248410204891400040C0000000000000000 |
---|
1144 | 00C402071042F000000000000000000000000000342844081C3870E1C38721108470E103908E103870E10847211C3908E1C38721102070842850881C3870E1C207081C384081C384081C39088103870E423840E1C3870C00040C0000000000000000 |
---|
1145 | 00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000047FFC0C0000000000000000 |
---|
1146 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1147 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000 |
---|
1148 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000 |
---|
1149 | 00C41FDE0C10300000000000000000000000000031C3870E1C3867F183877F1C3070EFE3870E183860E1C3870EFE3877FFFFC70E183870E183870C1C3BF8EFE3870E1DFFF8E1C33F8E1C3870E1C3870EFE3870E183870C03800C0000000000000000 |
---|
1150 | 00C402110C30300000000000000000000000000032448912244860818489082430912104891218486122448912104890810209121848912184890C2448412104891224204122430412244891224489121048912184890C03800C0000000000000000 |
---|
1151 | 00C40211125048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000 |
---|
1152 | 00C40211121048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000 |
---|
1153 | 00C4021E121048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000 |
---|
1154 | 00C402123F10FC00000000000000000000000000344891224481F887E8900840FD12010891227E89FA24089020108900810211207E811207E8913F44884201089022442042044FC4204081120448112010810207E8103C03800C0000000000000000 |
---|
1155 | 00C402112110840000000000000000000000000034489122448108842890084085120108912242890A2408902010890081021120428112042891214488420108902244204204484420408112044811201081020428102403800C0000000000000000 |
---|
1156 | 00C40211211084000000000000000000000000003244891224410884248808208491010489124249092204881010488081020910424091042489212448410104881224204102484410204091024409101040810424082403800C0000000000000000 |
---|
1157 | T 283 8 136 226.72726 98 778 22 T 1 db |
---|
1158 | 00C4021E121048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000 |
---|
1159 | 00C402123F10FC00000000000000000000000000344891224481F887E8900840FD12010891227E89FA24089020108900810211207E811207E8913F44884201089022442042044FC4204081120448112010810207E8103C03800C0000000000000000 |
---|
1160 | 00C402112110840000000000000000000000000034489122448108842890084085120108912242890A2408902010890081021120428112042891214488420108902244204204484420408112044811201081020428102403800C0000000000000000 |
---|
1161 | 00C40211211084000000000000000000000000003244891224410884248808208491010489124249092204881010488081020910424091042489212448410104881224204102484410204091024409101040810424082403800C0000000000000000 |
---|
1162 | 00C402112110840000000000000000000000000031C3870E1C3908842387081C8470E103870E423908E1C3870E1038708102070E423870E42387211C3840E103870E1C2040E1C8440E1C3870E1C3870E103870E423872403800C0000000000000000 |
---|
1163 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000 |
---|
1164 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000 |
---|
1165 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000 |
---|
1166 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000 |
---|
1167 | 00C41FDE0C10F00000000000000000000000000031C3870E1DFC67F183877F1C3070EFE3870E183860E1C3870EFE3877FFFFC70E183870E183870C1C3BF8EFE3870E1DFFF8E1C33F8E1C3870E19FC60E1DFC70E183870C03800C0000000000000000 |
---|
1168 | 00C402110C30880000000000000000000000000032448912242060818489082430912104891218486122448912104890810209121848912184890C2448412104891224204122430412244891218206122420912184890C03800C0000000000000000 |
---|
1169 | 00C40211125088000000000000000000000000003408102040209082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102024209204021020248101403800C0000000000000000 |
---|
1170 | 00C40211121088000000000000000000000000003408102040209082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102024209204021020248101403800C0000000000000000 |
---|
1171 | 00C4021E1210F0000000000000000000000000003408102040209082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102024209204021020248101403800C0000000000000000 |
---|
1172 | 00C402123F108800000000000000000000000000344891224021F887E8900840FD12010891227E89FA24089020108900810211207E811207E8913F44884201089022442042044FC42040811207E21FA240210207E8103C03800C0000000000000000 |
---|
1173 | 00C402112110880000000000000000000000000034489122402108842890084085120108912242890A2408902010890081021120428112042891214488420108902244204204484420408112042210A24021020428102403800C0000000000000000 |
---|
1174 | 00C40211211088000000000000000000000000003244891220210884248808208491010489124249092204881010488081020910424091042489212448410104881224204102484410204091042210922020810424082403800C0000000000000000 |
---|
1175 | 00C402112110F00000000000000000000000000031C3870E1C2108842387081C8470E103870E423908E1C3870E1038708102070E423870E42387211C3840E103870E1C2040E1C8440E1C3870E422108E1C2070E423872401000C0000000000000000 |
---|
1176 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1177 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1178 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1179 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1180 | 00C41FDE0E00000000000000000000000000000031C3870E1C3BFFF183070C183070E1C3BFFF19FC77F183870E1C33FFF1C3860C19FC70E1DFC77F183BF8E1C3877FFE3870C1DFC70E1C3860C1C3870E1C3BF8E1C3000402800C0000000000000000 |
---|
1181 | 00C4021112000000000000000000000000000000324489122448408183090C18309122448408182090818489122430408244860C1820912242090818484122448908104890C2420912244860C24489122448412243000401000C0000000000000000 |
---|
1182 | 00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800402800C0000000000000000 |
---|
1183 | 00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800401000C0000000000000000 |
---|
1184 | T 283 9 136 234.78259 98 778 23 T 1 db |
---|
1185 | 00C41FDE0E00000000000000000000000000000031C3870E1C3BFFF183070C183070E1C3BFFF19FC77F183870E1C33FFF1C3860C19FC70E1DFC77F183BF8E1C3877FFE3870C1DFC70E1C3860C1C3870E1C3BF8E1C3000402800C0000000000000000 |
---|
1186 | 00C4021112000000000000000000000000000000324489122448408183090C18309122448408182090818489122430408244860C1820912242090818484122448908104890C2420912244860C24489122448412243000401000C0000000000000000 |
---|
1187 | 00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800402800C0000000000000000 |
---|
1188 | 00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800401000C0000000000000000 |
---|
1189 | 00C4021E200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800402800C0000000000000000 |
---|
1190 | 00C40212200000000000000000000000000000003448902240884087EFD03F7EFD12044884087E211087E8902244FC4084481FBF7E2102044210087E884204089108108113F40210204489FBF4089022408042040FC00401000C0000000000000000 |
---|
1191 | 00C402112000000000000000000000000000000034489022408840842850214285120448840842211084289022448440844810A142210204421008428842040891081081121402102044890A140890224080420408400402800C0000000000000000 |
---|
1192 | 00C402111000000000000000000000000000000032448812204840842848214284910244840842209084248812248440824410A142208102420808424841020489081040921202081024490A120488122040410208400401000C0000000000000000 |
---|
1193 | 00C402110E00000000000000000000000000000031C3870E1C384084284721428470E1C384084220708423870E1C844081C390A1422070E1C20708423840E1C3870810387211C2070E1C390A11C3870E1C3840E1C8400402800C0000000000000000 |
---|
1194 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1195 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1196 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1197 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1198 | 00C41FDE3810000000000000000000000000000031C3860E1C3877F183BFFF1C3077F1C3877FFE3070C19FC60E1DFC70E1DFC77F1C3070E1C3070E1C3877F1C3870E1C3BFFF1C3860EFE3870E1DFC70E1DFFF8E1C3870C01000C0000000000000000 |
---|
1199 | 00C4021124300000000000000000000000000000324486122448908184840824309082448908103090C182061224209122420908243091224309122448908244891224484082448612104891224209122420412244891402800C0000000000000000 |
---|
1200 | 00C40211225000000000000000000000000000003408092040810082480408404900840810081049012242092040210204021008404902040490204081008408102040804084080920108102040210204020420408102401000C0000000000000000 |
---|
1201 | 00C40211221000000000000000000000000000003408092040810082480408404900840810081049012242092040210204021008404902040490204081008408102040804084080920108102040210204020420408102402800C0000000000000000 |
---|
1202 | 00C4021E221000000000000000000000000000003408092040810082480408404900840810081049012242092040210204021008404902040490204081008408102040804084080920108102040210204020420408102401000C0000000000000000 |
---|
1203 | 00C402122210000000000000000000000000000034489FA240891087E8840840FD108408910810FD13F7E21FA04021120402110840FD02240FD1224489108408902244884084089FA2108102044210204420420408902402800C0000000000000000 |
---|
1204 | 00C4021122100000000000000000000000000000344890A24089108428840840851084089108108512142210A0402112040211084085022408512244891084089022448840840890A2108102044210204420420408902401000C0000000000000000 |
---|
1205 | 00C40211241000000000000000000000000000003244909220489084248408208490820489081084921422109020209102020908208481220849122448908204881224484082049092104081024208102420410204881402800C0000000000000000 |
---|
1206 | 00C402113810000000000000000000000000000031C3908E1C3870842384081C847081C387081084721422108E1C2070E1C207081C8470E1C8470E1C387081C3870E1C384081C3908E103870E1C2070E1C2040E1C3870C01000C0000000000000000 |
---|
1207 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1208 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1209 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1210 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1211 | 00C41FDE3E10000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3870E1C3860E1C3870C02800C0000000000000000 |
---|
1212 | T 283 8 136 243.72726 98 778 22 T 1 db |
---|
1213 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1214 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1215 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1216 | 00C41FDE3E10000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3870E1C3860E1C3870C02800C0000000000000000 |
---|
1217 | 00C40211203000000000000000000000000000003242091224484082448412103090C24489122430912184861224489122420408243091224489121030612184891224204122430608244891210489122448612244890C01000C0000000000000000 |
---|
1218 | 00C40211205000000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010810204080920408101402800C0000000000000000 |
---|
1219 | 00C40211201000000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010810204080920408101401000C0000000000000000 |
---|
1220 | 00C4021E3C1000000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010810204080920408101402800C0000000000000000 |
---|
1221 | 00C4021220100000000000000000000000000000344210204080408408842010FD13F448902040FD1227E81FA04089020402040840FD022448112210FDFA07E89122442042044FDF88408102010891224489FA0448103C01000C0000000000000000 |
---|
1222 | 00C4021120100000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108912244890A0448102402800C0000000000000000 |
---|
1223 | 00C40211201000000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010489122449090244082401000C0000000000000000 |
---|
1224 | 00C402113E10000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E103870E1C3908E1C3872402800C0000000000000000 |
---|
1225 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1226 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1227 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1228 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1229 | 00C41FDE3E38000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3070E1C3860E1C3870C01000C0000000000000000 |
---|
1230 | 00C40211204400000000000000000000000000003242091224484082448412103090C24489122430912184861224489122420408243091224489121030612184891224204122430608244891210309122448612244890C02800C0000000000000000 |
---|
1231 | 00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101401000C0000000000000000 |
---|
1232 | 00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101402800C0000000000000000 |
---|
1233 | 00C4021E3C0800000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101401000C0000000000000000 |
---|
1234 | 00C4021220100000000000000000000000000000344210204080408408842010FD13F448902040FD1227E81FA04089020402040840FD022448112210FDFA07E89122442042044FDF88408102010FD1224489FA0448103C02800C0000000000000000 |
---|
1235 | 00C4021120200000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108512244890A0448102401000C0000000000000000 |
---|
1236 | 00C40211204000000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010849122449090244082402800C0000000000000000 |
---|
1237 | 00C402113E7C000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E108470E1C3908E1C3872401000C0000000000000000 |
---|
1238 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1239 | T 283 8 136 251.69564 98 778 23 T 1 db |
---|
1240 | 00C4021120200000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108512244890A0448102401000C0000000000000000 |
---|
1241 | 00C40211204000000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010849122449090244082402800C0000000000000000 |
---|
1242 | 00C402113E7C000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E108470E1C3908E1C3872401000C0000000000000000 |
---|
1243 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1244 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1245 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1246 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1247 | 00C41FDE3E38000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3070E1C3860E1C3870C02800C0000000000000000 |
---|
1248 | 00C40211204400000000000000000000000000003242091224484082448412103090C24489122430912184861224489122420408243091224489121030612184891224204122430608244891210309122448612244890C01000C0000000000000000 |
---|
1249 | 00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101402800C0000000000000000 |
---|
1250 | 00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101401000C0000000000000000 |
---|
1251 | 00C4021E3C1800000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101402800C0000000000000000 |
---|
1252 | 00C4021220040000000000000000000000000000344210204080408408842010FD13F448902040FD1227E81FA04089020402040840FD022448112210FDFA07E89122442042044FDF88408102010FD1224489FA0448103C01000C0000000000000000 |
---|
1253 | 00C4021120040000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108512244890A0448102402800C0000000000000000 |
---|
1254 | 00C40211204400000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010849122449090244082401000C0000000000000000 |
---|
1255 | 00C402113E38000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E108470E1C3908E1C3872402800C0000000000000000 |
---|
1256 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1257 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1258 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1259 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1260 | 00C41FDE1E00000000000000000000000000000031C3870E1C3867F183877F1C3077F1C3877F183860E1C3070E1C3867FFE3860C1833F8E1C3870EFE3BF8E1DFFF8E1DFFF8E1C33FFF1C3870C1DFC70E1C3870E183870C01000C0000000000000000 |
---|
1261 | 00C4021110000000000000000000000000000000324489122448608184890824309082448908184861224309122448608104860C183041224489121048412242041224204122430408244890C24209122448912184890C02800C0000000000000000 |
---|
1262 | 00C40211100000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101401000C0000000000000000 |
---|
1263 | 00C40211100000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101402800C0000000000000000 |
---|
1264 | 00C4021E1E0000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101401000C0000000000000000 |
---|
1265 | 00C4021210000000000000000000000000000000344810204489F887E8900840FD10840891087E89FA240FD1224489F881089FBF7EFC420408102210884204020422442042044FC408408113F442102044891207E8103C02800C0000000000000000 |
---|
1266 | 00C402111000000000000000000000000000000034481020448908842890084085108408910842890A24085122448908810890A1428442040810221088420402042244204204484408408112144210204489120428102401000C0000000000000000 |
---|
1267 | T 283 8 136 259.72726 98 778 22 T 1 db |
---|
1268 | 00C40211100000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101402800C0000000000000000 |
---|
1269 | 00C4021E1E0000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101401000C0000000000000000 |
---|
1270 | 00C4021210000000000000000000000000000000344810204489F887E8900840FD10840891087E89FA240FD1224489F881089FBF7EFC420408102210884204020422442042044FC408408113F442102044891207E8103C02800C0000000000000000 |
---|
1271 | 00C402111000000000000000000000000000000034481020448908842890084085108408910842890A24085122448908810890A1428442040810221088420402042244204204484408408112144210204489120428102401000C0000000000000000 |
---|
1272 | 00C402111000000000000000000000000000000032440810244908842488082084908204890842490922084912244908810490A1428441020408121048410202041224204102484408204092124208102448910424082402800C0000000000000000 |
---|
1273 | 00C402111000000000000000000000000000000031C3870E1C3908842387081C847081C38708423908E1C8470E1C3908810390A1428440E1C3870E103840E1C2040E1C2040E1C844081C387211C2070E1C3870E423872401000C0000000000000000 |
---|
1274 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1275 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1276 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1277 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1278 | 00C41FDE0E10000000000000000000000000000031C3870E1C3877F183BFFF1C3067F1C3BF8C1C3060E1C3070C1C3BFFF1C3870C183877F1DFC67F183870C1C3877FFE3870CFFFC70E1DFFF8E1C3870E1C3BF8E1C3000402800C0000000000000000 |
---|
1279 | 00C402111230000000000000000000000000000032448912244890818484082430608244840C2430612243090C2448408244890C18489082420608184890C2448908104890C1020912242041224489122448412243000401000C0000000000000000 |
---|
1280 | 00C40211205000000000000000000000000000003408102040810082480408404890840804124048920404901240804084081012248100840209082481012408100810810121021020402042040810204080420404800402800C0000000000000000 |
---|
1281 | 00C40211201000000000000000000000000000003408102040810082480408404890840804124048920404901240804084081012248100840209082481012408100810810121021020402042040810204080420404800401000C0000000000000000 |
---|
1282 | 00C4021E201000000000000000000000000000003408102040810082480408404890840804124048920404901240804084081012248100840209082481012408100810810121021020402042040810204080420404800402800C0000000000000000 |
---|
1283 | 00C40212221000000000000000000000000000003448112244811087E8840840FDF88448843F44FDFA044FD13F4480408408103F7E890084021F887E8113F4489108108113F102102040204204481020448042040FC00401000C0000000000000000 |
---|
1284 | 00C402112210000000000000000000000000000034481122448110842884084085088448842144850A0448512144804084081021428900840210884281121448910810811211021020402042044810204480420408400402800C0000000000000000 |
---|
1285 | 00C40211121000000000000000000000000000003244091224409084248408208508824484212485090248492124404082040821424880820210884240921244890810409211020810202041024408102440410208400401000C0000000000000000 |
---|
1286 | 00C402110E10000000000000000000000000000031C3870E1C3870842384081C850881C384211C8508E1C847211C384081C3872142387081C2108842387211C387081038721102070E1C2040E1C3870E1C3840E1C8400402800C0000000000000000 |
---|
1287 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1288 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1289 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1290 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1291 | 00C41FDE0E38000000000000000000000000000031C3870E1C3867F1C3BF8CFE3067F1C3877F19FFF8C1C3BF8E183870EFFFC70E183070EFE3867F1C33F8E1C3870EFFFC70E19FFF8E1C3870EFE3870E1C3877F1C3860401000C0000000000000000 |
---|
1292 | 00C4021112440000000000000000000000000000324489122448608244840C10306082448908182040C244841218489121020912183091210486082430412244891210209121820412244891210489122448908244860402800C0000000000000000 |
---|
1293 | 00C40211200400000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090401000C0000000000000000 |
---|
1294 | T 283 9 136 267.78259 98 778 23 T 1 db |
---|
1295 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1296 | 00C41FDE0E38000000000000000000000000000031C3870E1C3867F1C3BF8CFE3067F1C3877F19FFF8C1C3BF8E183870EFFFC70E183070EFE3867F1C33F8E1C3870EFFFC70E19FFF8E1C3870EFE3870E1C3877F1C3860401000C0000000000000000 |
---|
1297 | 00C4021112440000000000000000000000000000324489122448608244840C10306082448908182040C244841218489121020912183091210486082430412244891210209121820412244891210489122448908244860402800C0000000000000000 |
---|
1298 | 00C40211200400000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090401000C0000000000000000 |
---|
1299 | 00C40211200400000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090402800C0000000000000000 |
---|
1300 | 00C4021E200800000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090401000C0000000000000000 |
---|
1301 | 00C4021222100000000000000000000000000000344811224481F88408843F10FDF8844890087E2043F40804207E8902010210207EFD1201089F8844FC422408912210210227E204204081120108902040890084081F8402800C0000000000000000 |
---|
1302 | 00C40211222000000000000000000000000000003448112244810884088421108508844890084220421408042042890201021020428512010890884484422408912210210224220420408112010890204089008408108401000C0000000000000000 |
---|
1303 | 00C40211124000000000000000000000000000003244091224410882048421108508824488084220421204041042488101020810428491010490882484412204891210208124220410204091010488102048808204108402800C0000000000000000 |
---|
1304 | 00C402110E7C000000000000000000000000000031C3870E1C390881C3842110850881C3870842204211C3840E423870E102070E428470E10390881C8440E1C3870E102070E422040E1C3870E103870E1C387081C3908401000C0000000000000000 |
---|
1305 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1306 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1307 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1308 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1309 | 00C41FDE0E38000000000000000000000000000031C3870E1C3067F183877F1C3077FFE3877F183860E1C3070E183877FFE3870E183070EFE3870E1C3BF8E1C3870C1DFFF8E1C3077F1DFC70EFFFFF8E1C3870EFE3870C02800C0000000000000000 |
---|
1310 | 00C40211124400000000000000000000000000003244891224306081848908243090810489081848612243091218489081048912183091210489122448412244890C24204122430908242091210204122448912104890C01000C0000000000000000 |
---|
1311 | 00C40211200400000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101402800C0000000000000000 |
---|
1312 | 00C40211200400000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101401000C0000000000000000 |
---|
1313 | 00C4021E201800000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101402800C0000000000000000 |
---|
1314 | 00C40212220400000000000000000000000000003448112244FDF887E8900840FD10810891087E89FA240FD0227E8100810890207EFD12210811224488420448113F442042044FD108402102210204204081120108103C01000C0000000000000000 |
---|
1315 | 00C402112204000000000000000000000000000034481122448508842890084085108108910842890A2408502242810081089020428512210811224488420448112144204204485108402102210204204081120108102402800C0000000000000000 |
---|
1316 | 00C40211124400000000000000000000000000003244091224850884248808208490810489084249092208481242408081048810428491210409122448410244092124204102484908202081210204102040910104082401000C0000000000000000 |
---|
1317 | 00C402110E38000000000000000000000000000031C3870E1C8508842387081C847081038708423908E1C8470E4238708103870E428470E103870E1C3840E1C387211C2040E1C847081C2070E102040E1C3870E103872402800C0000000000000000 |
---|
1318 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1319 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1320 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1321 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1322 | T 283 8 136 276.72726 98 778 22 T 1 db |
---|
1323 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1324 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1325 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000 |
---|
1326 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1327 | 00C41FDE2210000000000000000000000000000031C3BF8E1C3BF8CFE3070EFE3860EFFFC70EFE3070C1C3870EFE3870CFFFC77F1C33FFF1C3860EFFFC77F1C3BF8E1C3BFFF1C3860CFE3870E19FFF8C1C3870C1C3870C01000C0000000000000000 |
---|
1328 | 00C402112230000000000000000000000000000032448412244840C103091210486121020912103090C2448912104890C102090824304082448612102090824484122448408244860C1048912182040C244890C244891402800C0000000000000000 |
---|
1329 | 00C40211225000000000000000000000000000003408042040804121049020108092010210201049012408102010810121021008404840840809201021008408042040804084080912108102024204124081012408102401000C0000000000000000 |
---|
1330 | 00C40211221000000000000000000000000000003408042040804121049020108092010210201049012408102010810121021008404840840809201021008408042040804084080912108102024204124081012408102402800C0000000000000000 |
---|
1331 | 00C4021E3E1000000000000000000000000000003408042040804121049020108092010210201049012408102010810121021008404840840809201021008408042040804084080912108102024204124081012408102401000C0000000000000000 |
---|
1332 | 00C402122210000000000000000000000000000034488422448043F10FD1201081FA2102112210FD13F4481020108913F102110844FC4084081FA21021108408842244884084089FBF10810207E2043F448103F408102402800C0000000000000000 |
---|
1333 | 00C4021122100000000000000000000000000000344884224480421108512010810A210211221085121448102010891211021108448440840810A210211084088422448840840890A1108102042204214481021408102401000C0000000000000000 |
---|
1334 | 00C402112210000000000000000000000000000032448412244042110849101041092102091210849212440810104892110209082484408204109210209082048412244840820490A1104081042204212440821204081402800C0000000000000000 |
---|
1335 | 00C402112210000000000000000000000000000031C3840E1C38421108470E103908E102070E10847211C3870E103872110207081C844081C3908E10207081C3840E1C384081C390A1103870E42204211C387211C3870C01000C0000000000000000 |
---|
1336 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000 |
---|
1337 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1338 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1339 | 00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000 |
---|
1340 | 00C41FDE3E1000000000000000000000000000003183870EFFFC77F183877F1C3070EFE3877FFE3070C1C3870E183870E1DFC70CFE3060E1C3BF8E183877F1C3877F1C3BFFF1C3060EFE3870C1DFC70C1C3870EFE3070C00040C0000000000000000 |
---|
1341 | 00C4021108300000000000000000000000000000318489121020908184890824309121048908103090C24489121848912242090C103061224484121848908244890824484082430612104890C242090C2448912103091400040C0000000000000000 |
---|
1342 | 00C40211085000000000000000000000000000003248102010210082481008404902010810081049012408102024810204021012104892040804202481008408100840804084048920108101240210124081020104902400040C0000000000000000 |
---|
1343 | 00C40211081000000000000000000000000000003248102010210082481008404902010810081049012408102024810204021012104892040804202481008408100840804084048920108101240210124081020104902400040C0000000000000000 |
---|
1344 | 00C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC7FFC0C0000000000000000 |
---|
1345 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1346 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1347 | 00C00000000000000000000000000000000000000080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1348 | 00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1349 | T 283 8 136 284.69564 98 778 23 T 1 db |
---|
1350 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1351 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1352 | 00C00000000000000000000000000000000000000080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1353 | 00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1354 | 00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1355 | 00C00000000000000000000000000000000000000080180000418080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1356 | 00C0000000000000000000000000000000000000008038000041C080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1357 | 00C0000000000000000000000000000000000000008078000041E080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1358 | 00C00000000000000000000000000000000000000080F8000041F0BFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA80400000C0000000000000000 |
---|
1359 | 00C00000000000000000000000000000000000000080F8000041F0BFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF555555555555555555555555555555540400000C0000000000000000 |
---|
1360 | 00C0000000000000000000000000000000000000008078000041E0BFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA80400000C0000000000000000 |
---|
1361 | 00C0000000000000000000000000000000000000008038000041C080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1362 | 00C00000000000000000000000000000000000000080180000418080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1363 | 00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1364 | 00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000 |
---|
1365 | 00C00000000000000000000000000000000000000F8FFFFFFFFFFF80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000007C00000C0000000000000000 |
---|
1366 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1367 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1368 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1369 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1370 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1371 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1372 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1373 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1374 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1375 | 00C001E0000000000F00000000000000030000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1376 | 00C001860000000043000000001E0000030180000C1F01E019F80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1377 | T 283 8 136 292.72726 98 778 22 T 1 db |
---|
1378 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1379 | 00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1380 | 00C001E0000000000F00000000000000030000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1381 | 00C001860000000043000000001E0000030180000C1F01E019F80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1382 | 00C0018600000000C300000000330000030780000C19833039F80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1383 | 00C00186361F1E37F301B0F0F9B301E3C33180001618C61858180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1384 | 00C001863B303336C301D99981B30336633180001618C61898300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1385 | 00C0018633383338C3019999C0330306630180002618C61918300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000 |
---|
1386 | 00000186331E3F30C3019998F0330306630180003F18C619FC60000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1387 | 0008018633073030C301999838330306630180006318C619FC60000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1388 | 0008018633033130C301999819B30316633180006319833018C0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1389 | 00080186333E1E307301F0F1F19E01E3C3318000631F01E018C0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1390 | 000801E0000000000F0180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1391 | 0008000000000000000180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1392 | 0008000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1393 | 0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1394 | 0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000 |
---|
1395 | 00003FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0040000000000000000 |
---|
1396 | 007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEFFC0000000000000000 |
---|
1397 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1398 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1399 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1400 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1401 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1402 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1403 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1404 | T 283 9 136 300.78259 98 778 23 T 1 db |
---|
1405 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1406 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1407 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1408 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1409 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1410 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1411 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1412 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1413 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1414 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1415 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1416 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1417 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1418 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1419 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1420 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1421 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1422 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1423 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1424 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1425 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1426 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1427 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1428 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1429 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1430 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1431 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1432 | 148 245 gm |
---|
1433 | (nc 139 244 151 330 6 rc)kp |
---|
1434 | 1 setTxMode |
---|
1435 | 12 fz |
---|
1436 | 2 F /|______Times-Roman fnt |
---|
1437 | -0.11044 0.(Command menus)ashow |
---|
1438 | 322 425 gm |
---|
1439 | (nc 313 424 325 474 6 rc)kp |
---|
1440 | -0.07157 0.(Scrollbars)ashow |
---|
1441 | 313 144 gm |
---|
1442 | (nc 304 143 316 195 6 rc)kp |
---|
1443 | -0.13261 0.(Status line)ashow |
---|
1444 | 250 92 gm |
---|
1445 | (nc 241 91 265 123 6 rc)kp |
---|
1446 | (Short)show |
---|
1447 | 262 92 gm |
---|
1448 | -0.16336 0.(names)ashow |
---|
1449 | 151 416 gm |
---|
1450 | (nc 142 415 166 464 6 rc)kp |
---|
1451 | -0.13940 0.(Sequence)ashow |
---|
1452 | 163 416 gm |
---|
1453 | -0.24850 0.(alignment)ashow |
---|
1454 | 0 0 gm |
---|
1455 | (nc 138 90 335 544 6 rc)kp |
---|
1456 | 0 gr |
---|
1457 | pr |
---|
1458 | 206 195 pl |
---|
1459 | 195 186 pl |
---|
1460 | 193 189 pl |
---|
1461 | 192 192 pl |
---|
1462 | 206 195 pl |
---|
1463 | 1 ep |
---|
1464 | 160 172 gm |
---|
1465 | 193 189 lin |
---|
1466 | pr |
---|
1467 | 223 361 pl |
---|
1468 | 211 368 pl |
---|
1469 | 213 371 pl |
---|
1470 | 216 373 pl |
---|
1471 | 223 361 pl |
---|
1472 | 1 ep |
---|
1473 | 169 415 gm |
---|
1474 | 213 371 lin |
---|
1475 | pr |
---|
1476 | 250 397 pl |
---|
1477 | 262 406 pl |
---|
1478 | 263 403 pl |
---|
1479 | 264 399 pl |
---|
1480 | 250 397 pl |
---|
1481 | 1 ep |
---|
1482 | 313 424 gm |
---|
1483 | 263 403 lin |
---|
1484 | pr |
---|
1485 | 295 325 pl |
---|
1486 | 294 340 pl |
---|
1487 | 298 339 pl |
---|
1488 | 301 338 pl |
---|
1489 | 295 325 pl |
---|
1490 | 1 ep |
---|
1491 | 313 424 gm |
---|
1492 | 298 339 lin |
---|
1493 | pr |
---|
1494 | 232 136 pl |
---|
1495 | 244 129 pl |
---|
1496 | 242 126 pl |
---|
1497 | 239 124 pl |
---|
1498 | 232 136 pl |
---|
1499 | 1 ep |
---|
1500 | 250 118 gm |
---|
1501 | 242 126 lin |
---|
1502 | 160 137 gm |
---|
1503 | (nc 151 136 163 170 6 rc)kp |
---|
1504 | 1 setTxMode |
---|
1505 | (Cursor)show |
---|
1506 | 331 218 gm |
---|
1507 | (nc 322 217 334 327 6 rc)kp |
---|
1508 | -0.10447 0.(Split screen drag point)ashow |
---|
1509 | 242 126 gm |
---|
1510 | (nc 138 90 335 544 6 rc)kp |
---|
1511 | 0 gr |
---|
1512 | pr |
---|
1513 | 291 384 pl |
---|
1514 | 301 373 pl |
---|
1515 | 298 372 pl |
---|
1516 | 294 370 pl |
---|
1517 | 291 384 pl |
---|
1518 | 1 ep |
---|
1519 | 322 325 gm |
---|
1520 | 298 372 lin |
---|
1521 | 233 472 gm |
---|
1522 | (nc 224 471 236 543 6 rc)kp |
---|
1523 | 1 setTxMode |
---|
1524 | -0.16412 0.(Scroll elevator)ashow |
---|
1525 | 298 372 gm |
---|
1526 | (nc 138 90 335 544 6 rc)kp |
---|
1527 | 0 gr |
---|
1528 | pr |
---|
1529 | 214 397 pl |
---|
1530 | 213 412 pl |
---|
1531 | 217 411 pl |
---|
1532 | 220 410 pl |
---|
1533 | 214 397 pl |
---|
1534 | 1 ep |
---|
1535 | 227 465 gm |
---|
1536 | 217 411 lin |
---|
1537 | pr |
---|
1538 | 195 228 pl |
---|
1539 | 181 229 pl |
---|
1540 | 182 232 pl |
---|
1541 | 183 236 pl |
---|
1542 | 195 228 pl |
---|
1543 | 1 ep |
---|
1544 | 150 243 gm |
---|
1545 | 182 232 lin |
---|
1546 | 197 460 gm |
---|
1547 | (nc 188 459 200 515 6 rc)kp |
---|
1548 | 1 setTxMode |
---|
1549 | -0.13102 0.(Resize tabs)ashow |
---|
1550 | 182 232 gm |
---|
1551 | (nc 138 90 335 544 6 rc)kp |
---|
1552 | 0 gr |
---|
1553 | pr |
---|
1554 | 185 401 pl |
---|
1555 | 184 416 pl |
---|
1556 | 188 415 pl |
---|
1557 | 191 414 pl |
---|
1558 | 185 401 pl |
---|
1559 | 1 ep |
---|
1560 | 195 454 gm |
---|
1561 | 188 415 lin |
---|
1562 | pr |
---|
1563 | 295 399 pl |
---|
1564 | 281 404 pl |
---|
1565 | 283 407 pl |
---|
1566 | 286 410 pl |
---|
1567 | 295 399 pl |
---|
1568 | 1 ep |
---|
1569 | 230 445 gm |
---|
1570 | 283 407 lin |
---|
1571 | 219 454 gm |
---|
1572 | 203 465 lin |
---|
1573 | 366 90 gm |
---|
1574 | (nc 31 30 761 582 6 rc)kp |
---|
1575 | 1 setTxMode |
---|
1576 | 10 fz |
---|
1577 | 2 F /|______Times-Roman fnt |
---|
1578 | 0.08865 0. 32 0.00886 0.(This is the sequence alignment editor. It consists of a color alignment display, a set of command menus,)awidthshow |
---|
1579 | 377 90 gm |
---|
1580 | 0.00823 0. 32 0.00082 0.(horizontal and vertical scroll bars to navigate the alignment, a list of short sequence names \(usually the)awidthshow |
---|
1581 | 388 90 gm |
---|
1582 | 0.02410 0. 32 0.00241 0.(LOCUS of a Genbank entry\), and a status line. The cursor is located in the upper left corner.)awidthshow |
---|
1583 | 421 90 gm |
---|
1584 | 12 fz |
---|
1585 | 2 F /|______Times-Roman fnt |
---|
1586 | -0.07032 0.(Using the Mouse)ashow |
---|
1587 | 444 90 gm |
---|
1588 | 10 fz |
---|
1589 | 2 F /|______Times-Roman fnt |
---|
1590 | -0.02319 0.(The mouse follow OpenLook standards for operation. The functions for each button are:)ashow |
---|
1591 | 0 0 gm |
---|
1592 | (nc 457 90 564 329 6 rc)kp |
---|
1593 | 64 gr |
---|
1594 | 476 178 563 238 17.5 17.5 1 rr |
---|
1595 | 0 gr |
---|
1596 | 476.5 178.5 562.5 237.5 17.5 17.5 0 rr |
---|
1597 | 64 gr |
---|
1598 | 491 189 525 196 17.5 17.5 1 rr |
---|
1599 | 0 gr |
---|
1600 | 491.5 189.5 524.5 195.5 17.5 17.5 0 rr |
---|
1601 | 64 gr |
---|
1602 | 491 204 525 212 17.5 17.5 1 rr |
---|
1603 | 0 gr |
---|
1604 | 491.5 204.5 524.5 211.5 17.5 17.5 0 rr |
---|
1605 | 64 gr |
---|
1606 | 491 219 525 227 17.5 17.5 1 rr |
---|
1607 | 0 gr |
---|
1608 | 491.5 219.5 524.5 226.5 17.5 17.5 0 rr |
---|
1609 | 142 315 107 239 th |
---|
1610 | 506 91 gm |
---|
1611 | tu |
---|
1612 | (nc 499 90 508 152 6 rc)kp |
---|
1613 | ts |
---|
1614 | 1 setTxMode |
---|
1615 | 12 fz |
---|
1616 | 2 F /|______Times-Roman fnt |
---|
1617 | -0.24205 0.(Object selection)ashow |
---|
1618 | tu |
---|
1619 | ts |
---|
1620 | 515 91 gm |
---|
1621 | tu |
---|
1622 | (nc 508 90 518 165 6 rc)kp |
---|
1623 | ts |
---|
1624 | -0.14672 0.(clicking & dragging)ashow |
---|
1625 | tu |
---|
1626 | ts |
---|
1627 | 506 269 gm |
---|
1628 | tu |
---|
1629 | (nc 499 269 508 328 6 rc)kp |
---|
1630 | ts |
---|
1631 | -0.20312 0.(Menu selection)ashow |
---|
1632 | tu |
---|
1633 | ts |
---|
1634 | 515 269 gm |
---|
1635 | tu |
---|
1636 | (nc 508 269 518 302 6 rc)kp |
---|
1637 | ts |
---|
1638 | -0.09335 0.(dragging)ashow |
---|
1639 | tu |
---|
1640 | 506 151 gm |
---|
1641 | (nc 457 90 564 329 6 rc)kp |
---|
1642 | 0 gr |
---|
1643 | 506 188 lin |
---|
1644 | 499 181 515 197 165 195 1 ar |
---|
1645 | 506 265 gm |
---|
1646 | 506 231 lin |
---|
1647 | 499 223 515 239 345 375 1 ar |
---|
1648 | ts |
---|
1649 | 464 186 gm |
---|
1650 | tu |
---|
1651 | (nc 457 185 466 237 6 rc)kp |
---|
1652 | ts |
---|
1653 | 1 setTxMode |
---|
1654 | -0.22036 0.(Object adjust)ashow |
---|
1655 | tu |
---|
1656 | 469 208 gm |
---|
1657 | (nc 457 90 564 329 6 rc)kp |
---|
1658 | 0 gr |
---|
1659 | 491 208 lin |
---|
1660 | 484 200 499 216 255 285 1 ar |
---|
1661 | 584 90 gm |
---|
1662 | (nc 31 30 761 582 6 rc)kp |
---|
1663 | 1 setTxMode |
---|
1664 | 10 fz |
---|
1665 | 2 F /|______Times-Roman fnt |
---|
1666 | 0.03082 0. 32 0.00308 0.(The left mouse button is used for placing the cursor, selecting sequences by their short names,)awidthshow |
---|
1667 | 595 90 gm |
---|
1668 | 0.11825 0. 32 0.01182 0.(scrolling/paging, performing split screens, and resizing. The right button is used for pop up menus, and)awidthshow |
---|
1669 | 606 90 gm |
---|
1670 | (scrollbar menus. The middle button is used for extending a text selection.)show |
---|
1671 | 628 90 gm |
---|
1672 | 12 fz |
---|
1673 | 2 F /|______Times-Roman fnt |
---|
1674 | -0.11749 0.(Cursor Movement)ashow |
---|
1675 | 651 90 gm |
---|
1676 | 10 fz |
---|
1677 | 2 F /|______Times-Roman fnt |
---|
1678 | (The cursor can be moved using the arrow keys, or by clicking the mouse within a sequence. The cursors)show |
---|
1679 | 662 90 gm |
---|
1680 | 0.14465 0. 32 0.01446 0.(position is displayed on the status line in both sequence position and alignment column number. The right)awidthshow |
---|
1681 | 673 90 gm |
---|
1682 | 0.06561 0. 32 0.00656 0.(hand side of the status line shows the left and right column positions of the currently active display.)awidthshow |
---|
1683 | 695 90 gm |
---|
1684 | 0.07385 0. 32 0.00738 0.(Scrolling is controlled by the scrollbar elevator. By clicking \(left mouse button\) on one of the elevator)awidthshow |
---|
1685 | 706 90 gm |
---|
1686 | -0.03851 0.(arrows, the screen will scroll one character in that direction. By dragging the elevator center, the screen can)ashow |
---|
1687 | 717 90 gm |
---|
1688 | -0.00059 0.(be moved directly to any location. By clicking directly to one side of the elevator, the screen will scroll one)ashow |
---|
1689 | F T cp |
---|
1690 | %%Page: ? 5 |
---|
1691 | op |
---|
1692 | 31 30 xl |
---|
1693 | 1 1 pen |
---|
1694 | 753 90 gm |
---|
1695 | (nc 31 30 761 582 6 rc)kp |
---|
1696 | 1 setTxMode |
---|
1697 | 0 fs |
---|
1698 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
1699 | 7 fz |
---|
1700 | 2 F /|______Times-Roman fnt |
---|
1701 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
1702 | 753 303 gm |
---|
1703 | 12 fz |
---|
1704 | 2 F /|______Times-Roman fnt |
---|
1705 | (5)show |
---|
1706 | 81 90 gm |
---|
1707 | 10 fz |
---|
1708 | 2 F /|______Times-Roman fnt |
---|
1709 | 0.07583 0. 32 0.00758 0.(full screen in that direction. And by clicking on the scrollbar anchor, the elevator will move to that anchor.)awidthshow |
---|
1710 | 92 90 gm |
---|
1711 | 0.20538 0. 32 0.02053 0.(Scrollbars also have menus associated with them giving other scroll options. Use the right mouse button to)awidthshow |
---|
1712 | 103 90 gm |
---|
1713 | (activate the menu.)show |
---|
1714 | F T cp |
---|
1715 | %%Page: ? 6 |
---|
1716 | op |
---|
1717 | 31 30 xl |
---|
1718 | 1 1 pen |
---|
1719 | 753 90 gm |
---|
1720 | (nc 31 30 761 582 6 rc)kp |
---|
1721 | 1 setTxMode |
---|
1722 | 0 fs |
---|
1723 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
1724 | 7 fz |
---|
1725 | 2 F /|______Times-Roman fnt |
---|
1726 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
1727 | 753 303 gm |
---|
1728 | 12 fz |
---|
1729 | 2 F /|______Times-Roman fnt |
---|
1730 | (6)show |
---|
1731 | 92 90 gm |
---|
1732 | -0.12741 0.(Selecting Sequences)ashow |
---|
1733 | 115 90 gm |
---|
1734 | 10 fz |
---|
1735 | 2 F /|______Times-Roman fnt |
---|
1736 | -0.05250 0.(Sequence selection is necessary before most functions can be performed. Selecting sequences is)ashow |
---|
1737 | 126 90 gm |
---|
1738 | -0.03315 0.(accomplished by clicking or dragging \(left button\) over the short name associated with the sequence\(s\). The)ashow |
---|
1739 | 137 90 gm |
---|
1740 | -0.01461 0.(name of the sequence should become highlighted on the release of the mouse button. By holding down the)ashow |
---|
1741 | 148 90 gm |
---|
1742 | 0.13977 0. 32 0.01397 0.(shift key, you can toggle the selection on or off for any set of sequences. By clicking just to the right of)awidthshow |
---|
1743 | 159 90 gm |
---|
1744 | -0.00563 0.(any sequence short name, you will deselect all of them.)ashow |
---|
1745 | 181 90 gm |
---|
1746 | 12 fz |
---|
1747 | 2 F /|______Times-Roman fnt |
---|
1748 | -0.20321 0.(Selecting Text)ashow |
---|
1749 | 204 90 gm |
---|
1750 | 10 fz |
---|
1751 | 2 F /|______Times-Roman fnt |
---|
1752 | -0.00436 0.(Selecting text is accomplished in much the same way as selecting entire sequences. In the editing window,)ashow |
---|
1753 | 215 90 gm |
---|
1754 | 0.04013 0. 32 0.00401 0.(you can drag the mouse pointer over a rectangular region the select a block of text. By using the shift key)awidthshow |
---|
1755 | 226 90 gm |
---|
1756 | -0.01466 0.(\(or the middle mouse button\) you can adjust the selection to include other sequences, or other columns of)ashow |
---|
1757 | 237 90 gm |
---|
1758 | -0.01264 0.(text. If groups are enabled, GDE will automatically select all sequences in a group if any one sequence in a)ashow |
---|
1759 | 248 90 gm |
---|
1760 | -0.07606 0.(group is selected \(See Sequence Editing\).)ashow |
---|
1761 | 270 90 gm |
---|
1762 | 12 fz |
---|
1763 | 2 F /|______Times-Roman fnt |
---|
1764 | -0.12741 0.(Sequence Protection)ashow |
---|
1765 | 293 90 gm |
---|
1766 | 10 fz |
---|
1767 | 2 F /|______Times-Roman fnt |
---|
1768 | -0.05520 0.(All sequences can be individually protected against accidental modification. This is accomplished by)ashow |
---|
1769 | 304 90 gm |
---|
1770 | -0.01127 0.(selecting the set of sequences that you are interested in editing, and choosing the "Set protections" menu)ashow |
---|
1771 | 315 90 gm |
---|
1772 | 0.03738 0. 32 0.00373 0.(item under the File menu. Your choices are:)awidthshow |
---|
1773 | 337 90 gm |
---|
1774 | -0.03042 0.(Unambiguous modification)ashow |
---|
1775 | 337 306 gm |
---|
1776 | -0.13563 0.(Changing/adding/deleting regular characters)ashow |
---|
1777 | 348 90 gm |
---|
1778 | -0.02313 0.(Ambiguous changes)ashow |
---|
1779 | 348 306 gm |
---|
1780 | 0.28198 0. 32 0.02819 0.(Changing ambiguous codes \('N', 'X'...\))awidthshow |
---|
1781 | 359 90 gm |
---|
1782 | -0.01168 0.(Alignment modifications)ashow |
---|
1783 | 359 306 gm |
---|
1784 | 0.23391 0. 32 0.02339 0.(Changing alignment gaps \('-', '~'\))awidthshow |
---|
1785 | 381 90 gm |
---|
1786 | 12 fz |
---|
1787 | 2 F /|______Times-Roman fnt |
---|
1788 | -0.15385 0.(Sequence Editing)ashow |
---|
1789 | 404 90 gm |
---|
1790 | 10 fz |
---|
1791 | 2 F /|______Times-Roman fnt |
---|
1792 | -0.04483 0.(Sequences can be edited by simply typing to insert, and using the delete or backspace key to delete characters.)ashow |
---|
1793 | 415 90 gm |
---|
1794 | 0.05371 0. 32 0.00537 0.(Sequences must have the proper protections set to allow the type of modifications that you are attempting.)awidthshow |
---|
1795 | 426 90 gm |
---|
1796 | 0.06790 0. 32 0.00679 0.(The default protection level only allows modification to the alignment, but not to the sequences themselves.)awidthshow |
---|
1797 | 437 90 gm |
---|
1798 | -0.00852 0.(The Sun function keys, cut, copy and paste are used to edit selected text. Text selections work in rectangular)ashow |
---|
1799 | 448 90 gm |
---|
1800 | (\(possibly disjointed\) regions. You can cut or copy a block of sequence text, and paste it to a new cursor)show |
---|
1801 | 459 90 gm |
---|
1802 | 0.10787 0. 32 0.01078 0.(location using these three keys.)awidthshow |
---|
1803 | 492 90 gm |
---|
1804 | 12 fz |
---|
1805 | 2 F /|______Times-Roman fnt |
---|
1806 | -0.16456 0.(Sequence Yanking:)ashow |
---|
1807 | 515 90 gm |
---|
1808 | 10 fz |
---|
1809 | 2 F /|______Times-Roman fnt |
---|
1810 | 0.03494 0. 32 0.00349 0.(Yanking referes to the "pulling" of a base to fill a gapped position like beads on an abacus. Place the cursor)awidthshow |
---|
1811 | 526 90 gm |
---|
1812 | 0.01922 0. 32 0.00192 0.(over a gap character, and type <crtl> k to yank the character from the left into the current position. Type)awidthshow |
---|
1813 | 537 90 gm |
---|
1814 | 0.05645 0. 32 0.00564 0.(<ctrl>l to pull the character from the right. Repeat counts are honored \("20 <ctrl> l" will yank 20 characters)awidthshow |
---|
1815 | 548 90 gm |
---|
1816 | 0.18218 0. 32 0.01821 0.(from the right\).)awidthshow |
---|
1817 | F T cp |
---|
1818 | %%Page: ? 7 |
---|
1819 | op |
---|
1820 | 31 30 xl |
---|
1821 | 1 1 pen |
---|
1822 | 753 90 gm |
---|
1823 | (nc 31 30 761 582 6 rc)kp |
---|
1824 | 1 setTxMode |
---|
1825 | 0 fs |
---|
1826 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
1827 | 7 fz |
---|
1828 | 2 F /|______Times-Roman fnt |
---|
1829 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
1830 | 753 303 gm |
---|
1831 | 12 fz |
---|
1832 | 2 F /|______Times-Roman fnt |
---|
1833 | (7)show |
---|
1834 | 92 90 gm |
---|
1835 | -0.11007 0.(Repeat Counts)ashow |
---|
1836 | 115 90 gm |
---|
1837 | 10 fz |
---|
1838 | 2 F /|______Times-Roman fnt |
---|
1839 | -0.02497 0.(By typing a numeric value before an editing function you can insert, delete or move a number of characters at)ashow |
---|
1840 | 126 90 gm |
---|
1841 | -0.00587 0.(a time. The current repeat count is displayed on the status line, and can be cleared by clicking the left mouse)ashow |
---|
1842 | 137 90 gm |
---|
1843 | 0.08789 0. 32 0.00878 0.(button in the alignment window. In order to insert twenty gaps into a sequence, one would type "20-". In)awidthshow |
---|
1844 | 148 90 gm |
---|
1845 | -0.02680 0.(order to move down five sequences, one would type "5)ashow |
---|
1846 | {}mark T /Helvetica /|______Helvetica 0 rf |
---|
1847 | 7.27995 fz |
---|
1848 | 2 F /|______Helvetica fnt |
---|
1849 | (\257)show |
---|
1850 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
1851 | 10 fz |
---|
1852 | 2 F /|______Times-Roman fnt |
---|
1853 | -0.02607 0.(". This works with all sequence types, however the)ashow |
---|
1854 | 159 90 gm |
---|
1855 | -0.01254 0.(meta \(diamond\) key must be held down when the cursor is in a text or mask sequence. This is because)ashow |
---|
1856 | 170 90 gm |
---|
1857 | -0.07215 0.(numbers are valid characters in these sequences, and would otherwise be confused with repeat counts.)ashow |
---|
1858 | 192 90 gm |
---|
1859 | 12 fz |
---|
1860 | 2 F /|______Times-Roman fnt |
---|
1861 | -0.11955 0.(Split Screen)ashow |
---|
1862 | 215 90 gm |
---|
1863 | 10 fz |
---|
1864 | 2 F /|______Times-Roman fnt |
---|
1865 | 0.11734 0. 32 0.01173 0.(Split screen editing allows the viewing one region while editing another. This is very useful for aligning)awidthshow |
---|
1866 | 226 90 gm |
---|
1867 | -0.03680 0.("downstream" regions by editing "upstream".)ashow |
---|
1868 | 248 90 gm |
---|
1869 | 0.14480 0. 32 0.01448 0.(The alignment window can be split horizontally into two or more windows into the alignment. These)awidthshow |
---|
1870 | 259 90 gm |
---|
1871 | -0.03460 0.(windows scroll independently of each other both horizontally and vertically. The short names displayed to)ashow |
---|
1872 | 270 90 gm |
---|
1873 | -0.01350 0.(the left of the alignment correspond to the window that was last scrolled or edited. Care should be taken in)ashow |
---|
1874 | 281 90 gm |
---|
1875 | -0.04472 0.(any modifications done in this mode so that edits are performed on the correct sequence. To avoid confusion)ashow |
---|
1876 | 292 90 gm |
---|
1877 | 0.00595 0. 32 0.00059 0.(during split screen operations, the vertical scroll bars may be locked so that all windows scroll together.)awidthshow |
---|
1878 | 0 0 gm |
---|
1879 | (nc 294 162 447 412 6 rc)kp |
---|
1880 | 64 gr |
---|
1881 | 295 163 415 411 1 rc |
---|
1882 | T 248 15.90908 163 295 70 554 35 T 1 db |
---|
1883 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1884 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1885 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1886 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1887 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1888 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1889 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
1890 | 00000FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0000000 |
---|
1891 | 00001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0020000 |
---|
1892 | 00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
1893 | 00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020020000 |
---|
1894 | 0007F3FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE7E20000 |
---|
1895 | 00040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
1896 | 00040000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
1897 | 00040000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
1898 | 00040000020000000000000000000000000000000000000000000000000030000000000000000003000000000000000000000000000000000000000000000000000000020000 |
---|
1899 | 0004001FC200000000000000000000000000000000000000000F0000000430003E00080007E00003000000000000008000000000000000000000000000000000000000020000 |
---|
1900 | 003C001F820000000000000000000000000000000000000000198000000C000033001800060000000000000000000180000000000000000000000000000000000000001E0000 |
---|
1901 | 0060000F020000000000000000000000000000000000000000300F0D879F31E0318F3E780606C66336786C3661E1B3E000000000000000000000000000000000000000060000 |
---|
1902 | 0060000F02000000000000000000000000000000000000000030198ECCCC3330319998CC0607666336CC763BB331D98000000000000000000000000000000000000000060000 |
---|
1903 | 0060000602000000000000000000000000000000000000000030198CCCCC33003181980C07C6666338CC66333331998000000000000000000000000000000000000000060000 |
---|
1904 | 00600006020000000000000000000000000000000000000000319F8CCFCC3300318F987C0606634330CC663333F1998000000000000000000000000000000000000000060000 |
---|
1905 | 0060000002000000000000000000000000000000000000000031980CCC0C3300319998CC0606634330CC66333301998000000000000000000000000000000000000000060000 |
---|
1906 | 0060000002000000000000000000000000000000000000000019988CCC4C3310331998CC0606618330CC66333311998000000000000000000000000000000000000000060000 |
---|
1907 | 006000000200000000000000000000000000000000000000000F8F0CC78731E03E0ECE7607E661833078663331E198E000000000000000000000000000000000000000060000 |
---|
1908 | 00600000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1909 | 006000FFFC0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1910 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1911 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1912 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1913 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000460000 |
---|
1914 | 0061FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC60000 |
---|
1915 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1916 | 0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC60000 |
---|
1917 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1918 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1919 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1920 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1921 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1922 | T 248 15 163 310.88232 70 554 34 T 1 db |
---|
1923 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1924 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1925 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1926 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1927 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1928 | 00600000088000000800000001100000040000000000002000000000010000000000000100000008000000000000000000200000000000000000000000000000000000060000 |
---|
1929 | 00600007888000000400001F011100000200000F8210C0278421800000800001E00010010000000400001F002000000000100000000000000000000000000000000000060000 |
---|
1930 | 00600004008000000400001001010000020000084310C04446218000008000011000100000000004000010002000000000100000000000000000000000000000000000060000 |
---|
1931 | 00600004088E00FE020000100F13C07F01000008231120444622401FC040000112C63CE11600FE02000010227ACE1C03F8080000000000000000000000000000000000060000 |
---|
1932 | 00600004089100FC020000101111007E01000008229120844522401F80400001130911111900FC020000102223112003F0080000000000000000000000000000000000060000 |
---|
1933 | 00600007889100780200001E1111003C0100000822D1208785A2400F00400001121091111100780200001E1422012001E0080000000000000000000000000000000000060000 |
---|
1934 | 00600004089F0078020000101111003C010000082253F08484A7E00F00400001E21091F11100780200001008220F1801E0080000000000000000000000000000000000060000 |
---|
1935 | 006000040890003002000010111100180100000822321104446420060040000102109101110030020000101422110400C0080000000000000000000000000000000000060000 |
---|
1936 | 006000040891003002000010131100180100000842321104446420060040000102091111110030020000102222110400C0080000000000000000000000000000000000060000 |
---|
1937 | 00600004088E00000200001F0D10C0000100000F82121204442420000040000102060CE11100000200001F221A0EB80000080000000000000000000000000000000000060000 |
---|
1938 | 00600000000000000400000000000000020000000000020000000000008000000000000000000004000000000000000000100000000000000000000000000000000000060000 |
---|
1939 | 00600000000000000400000000000000020000000000000000000000008000000000000000000004000000000000000000100000000000000000000000000000000000060000 |
---|
1940 | 00600000000000000800000000000000040000000000000000000000010000000000000000000008000000000000000000200000000000000000000000000000000000060000 |
---|
1941 | 00600400000000001000080000000000080004000000000000000000020001000000000000000010000800000000000000400000000000000000000000000000000000060000 |
---|
1942 | 006003000000000060000600000000003000030000000000000000000C0000C00000000000000060000600000000000001800000000000000000000000000000000000060000 |
---|
1943 | 006000FFFFFFFFFF800001FFFFFFFFFFC00000FFFFFFFFFFFFFFFFFFF000003FFFFFFFFFFFFFFF800001FFFFFFFFFFFFFE000000000000000000000000000000000000060000 |
---|
1944 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1945 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1946 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1947 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1948 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1949 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1950 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1951 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1952 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1953 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1954 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1955 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1956 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
1957 | 0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE00023FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0002060000 |
---|
1958 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1959 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1960 | 00620000000000000000000000000000000000001FF00000000000000000000000000000000200023FC000000000000000000000000000000000000000000000020002060000 |
---|
1961 | T 248 15 163 325.90908 70 554 33 T 1 db |
---|
1962 | 0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE00023FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0002060000 |
---|
1963 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1964 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1965 | 00620000000000000000000000000000000000001FF00000000000000000000000000000000200023FC000000000000000000000000000000000000000000000020002060000 |
---|
1966 | 00620000000000000000000000000000000000001FF00000000000000000000000000000000200023FC000000000000000000000000000000000000000000000020002060000 |
---|
1967 | 00620FEF060878000000000000000000000000001F11C0070E1DFC67F183877F1C3070EFE3863FFE3C47001C3877F19FC60E1DFC70C1C3BF8E1C3800C1C3070E1E3FFE060000 |
---|
1968 | 00620108861844000000000000000000000000001ED24009122420608184890824309121048A00003B490024489081820612242090C2448412244800C2430912260000060000 |
---|
1969 | 00620108892844000000000000000000000000001DF400102040209082481008404902010812000037D000408100824209204021012408042040800124049020420000060000 |
---|
1970 | 00620108890844000000000000000000000000001DF400102040209082481008404902010812000037D000408100824209204021012408042040800124049020420000060000 |
---|
1971 | 0062010F090878000000000000000000000000001DF400102040209082481008404902010812000237D000408100824209204021012408042040800124049020420002060000 |
---|
1972 | 006201091F8844000000000000000000000000001DD44011224021F887E8900840FD12010892000237510044890087E21FA2402103F4480422448803F44FD120460002060000 |
---|
1973 | 00620108908844000000000000000000000000001DD4401122402108842890084085120108920002375100448900842210A24021021448042244880214485120460002060000 |
---|
1974 | 00620108908844000000000000000000000000001ED24009122021088424880820849101048A00023B4900244880842210922020821244041224480212484910260002060000 |
---|
1975 | 00620108908878000000000000000000000000001F11C0070E1C2108842387081C8470E1038601823C47001C38708422108E1C207211C3840E1C380211C8470E1E0182060000 |
---|
1976 | 00620000000000000000000000000000000000001FF00000000000000000000000000000000203C23FC0000000000000000000000000000000000000000000000203C2060000 |
---|
1977 | 00620000000000000000000000000000000000001FF00000000000000000000000000000000207E23FC0000000000000000000000000000000000000000000000207E2060000 |
---|
1978 | 00620000000000000000000000000000000000001800000000000000000000000000000000020FF2200000000000000000000000000000000000000000000000020FF2060000 |
---|
1979 | 00620000000000000000000000000000000000001800000000000000000000000000000000020FF2200000000000000000000000000000000000000000000000020FF2060000 |
---|
1980 | 00620FEF0700000000000000000000000000000018E1C3870E1DFC07F183070C18307001C386000223870E1C3877F01FC60C1C3060C1C0070E1DFFF8CFE0077F1A0002060000 |
---|
1981 | 006201088900000000000000000000000000000019224489122420008183090C18309002448A00022489122448908002060C243060C2400912242040C10009081A0002060000 |
---|
1982 | 00620108900000000000000000000000000000001A04081020402000824490122449000408120002281020408100800209124048912400102040204121001008260002060000 |
---|
1983 | 00620108900000000000000000000000000000001A04081020402000824490122449000408120002281020408100800209124048912400102040204121001008260002060000 |
---|
1984 | 0062010F100000000000000000000000000000001A04081020402000824490122449000408120002281020408100800209124048912400102040204121001008260002060000 |
---|
1985 | 00620109100000000000000000000000000000001A2448112044200087EFD03F7EFD10040892000228912044811080021FBF40FDFBF4401022442043F10011087E0002060000 |
---|
1986 | 00620108900000000000000000000000000000001A24481120442000842850214285100408920002289120448110800210A140850A1440102244204211001108420002060000 |
---|
1987 | 006201088800000000000000000000000000000019224409102420008428482142849002048A0002248910244090800210A120850A1240081224204211000908420002060000 |
---|
1988 | 006201088700000000000000000000000000000018E1C3870E1C20008428472142847001C386000223870E1C3870800210A11C850A11C0070E1C204211000708420002060000 |
---|
1989 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1990 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1991 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1992 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
1993 | 00620FEF1C08000000000000000000000000000018E1C0060E1C3877F183BFFF1C3077F1C3860002238700183870E1DFC60EFFFC70C1DFC70E1DFFF8C1C3067F1A0002060000 |
---|
1994 | 006201089218000000000000000000000000000019224006122448908184840824309082448A000224890018489122420612102090C2420912242040C24306081A0002060000 |
---|
1995 | 00620108912800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000 |
---|
1996 | 00620108910800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000 |
---|
1997 | 0062010F110800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000 |
---|
1998 | 00620109110800000000000000000000000000001A24401FA240891087E8840840FD1084089200022891007E890224421FA2102103F4421022442043F44FDF887E0002060000 |
---|
1999 | T 248 15 163 340.88232 70 554 34 T 1 db |
---|
2000 | 00620108912800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000 |
---|
2001 | 00620108910800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000 |
---|
2002 | 0062010F110800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000 |
---|
2003 | 00620109110800000000000000000000000000001A24401FA240891087E8840840FD1084089200022891007E890224421FA2102103F4421022442043F44FDF887E0002060000 |
---|
2004 | 00620108910800000000000000000000000000001A244010A2408910842884084085108408920002289100428902244210A21021021442102244204214485088420002060000 |
---|
2005 | 006201089208000000000000000000000000000019224010922048908424840820849082048A3FFE248900424881224210921020821242081224204212485088423FFE060000 |
---|
2006 | 006201089C08000000000000000000000000000018E1C0108E1C3870842384081C847081C3860002238700423870E1C2108E10207211C2070E1C204211C85088420002060000 |
---|
2007 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2008 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2009 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2010 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2011 | 00620FEF1F08000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C3860FF223BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A0FF2060000 |
---|
2012 | 0062010890180000000000000000000000000000192104891224200082448412103090C2448A0FF224841224489080020912104840C2430912244890C24486121A0FF2060000 |
---|
2013 | 00620108902800000000000000000000000000001A010810204020008408042010490124081207E22804204081008002102010804124049020408101240809202607E2060000 |
---|
2014 | 00620108900800000000000000000000000000001A010810204020008408042010490124081203C22804204081008002102010804124049020408101240809202603C2060000 |
---|
2015 | 0062010F1E0800000000000000000000000000001A01081020402000840804201049012408120182280420408100800210201080412404902040810124080920260182060000 |
---|
2016 | 00620109100800000000000000000000000000001A210810204020008408842010FD13F44892000228842040810080021022108043F44FD122408103F4489FA07E0002060000 |
---|
2017 | 00620108900800000000000000000000000000001A210810204020008408842010851214489200022884204081008002102210804214485122408102144890A0420002060000 |
---|
2018 | 006201089008000000000000000000000000000019210408102020008204841010849212448A0002248410204080800208121040421248491220408212449090420002060000 |
---|
2019 | 006201089F08000000000000000000000000000018E103870E1C200081C3840E10847211C386000223840E1C38708002070E10384211C8470E1C387211C3908E420002060000 |
---|
2020 | 00620000000000000000000000000000000000001800000000000000000000000000000000023FFE200000000000000000000000000000000000000000000000023FFE060000 |
---|
2021 | 00620000000000000000000000000000000000001800000000000000000000000000000000020000200000000000000000000000000000000000000000000000020000060000 |
---|
2022 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2023 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2024 | 00620FEF1F1C000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C38601C023BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A01C0060000 |
---|
2025 | 0062010890220000000000000000000000000000192104891224200082448412103090C2448A01C024841224489080020912104840C2430912244890C24486121A01C0060000 |
---|
2026 | 00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000 |
---|
2027 | 00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000 |
---|
2028 | 0062010F1E0400000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000 |
---|
2029 | 00620109100800000000000000000000000000001A210810204020008408842010FD13F4489201C028842040810080021022108043F44FD122408103F4489FA07E01C0060000 |
---|
2030 | 00620108901000000000000000000000000000001A210810204020008408842010851214489201C02884204081008002102210804214485122408102144890A04201C0060000 |
---|
2031 | 006201089020000000000000000000000000000019210408102020008204841010849212448A01C02484102040808002081210404212484912204082124490904201C0060000 |
---|
2032 | 006201089F3E000000000000000000000000000018E103870E1C200081C3840E10847211C38601C023840E1C38708002070E10384211C8470E1C387211C3908E4201C0060000 |
---|
2033 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2034 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2035 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2036 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2037 | 00620FEF1F1C000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C38601C023BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A01C0060000 |
---|
2038 | T 248 15 163 355.90908 70 554 33 T 1 db |
---|
2039 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2040 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2041 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2042 | 00620FEF1F1C000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C38601C023BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A01C0060000 |
---|
2043 | 0062010890220000000000000000000000000000192104891224200082448412103090C2448A01C024841224489080020912104840C2430912244890C24486121A01C0060000 |
---|
2044 | 00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000 |
---|
2045 | 00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000 |
---|
2046 | 0062010F1E0C00000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000 |
---|
2047 | 00620109100200000000000000000000000000001A210810204020008408842010FD13F4489201C028842040810080021022108043F44FD122408103F4489FA07E01C0060000 |
---|
2048 | 00620108900200000000000000000000000000001A210810204020008408842010851214489201C02884204081008002102210804214485122408102144890A04201C0060000 |
---|
2049 | 006201089022000000000000000000000000000019210408102020008204841010849212448A01C02484102040808002081210404212484912204082124490904201C0060000 |
---|
2050 | 006201089F1C000000000000000000000000000018E103870E1C200081C3840E10847211C38601C023840E1C38708002070E10384211C8470E1C387211C3908E4201C0060000 |
---|
2051 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2052 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2053 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2054 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2055 | 00620FEF0F00000000000000000000000000000018E1C3870E1C0067F183877F1C3077F1C38601C023870E1C3870019FC60E1DFC70C1DFC70E1C03F8C1C3070E1A01C0060000 |
---|
2056 | 006201088800000000000000000000000000000019224489122400608184890824309082448A01C024891224489001820612242090C2420912240040C24309121A01C0060000 |
---|
2057 | 00620108880000000000000000000000000000001A040810204000908248100840490084081201C02810204081000242092040210124021020400041240490202601C0060000 |
---|
2058 | 00620108880000000000000000000000000000001A040810204000908248100840490084081201C02810204081000242092040210124021020400041240490202601C0060000 |
---|
2059 | 0062010F0F0000000000000000000000000000001A040810204000908248100840490084081201C02810204081000242092040210124021020400041240490202601C0060000 |
---|
2060 | 00620109080000000000000000000000000000001A240810224401F887E8900840FD1084089201C028902040891007E21FA2402103F4421022440043F44FD1207E01C0060000 |
---|
2061 | 00620108880000000000000000000000000000001A240810224401088428900840851084089201C0289020408910042210A240210214421022440042144851204201C0060000 |
---|
2062 | 006201088800000000000000000000000000000019220408122401088424880820849082048A01C02488102048900422109220208212420812240042124849104201C0060000 |
---|
2063 | 006201088800000000000000000000000000000018E1C3870E1C0108842387081C847081C38601C023870E1C38700422108E1C207211C2070E1C004211C8470E4201C0060000 |
---|
2064 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2065 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2066 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2067 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2068 | 00620FEF0708000000000000000000000000000018E003870E1C3877F183BFFF1C3067F0038601C023800E1C3870E1DFC60EFFFC70C19FC00E1C03F8C1C3060E1E01C0060000 |
---|
2069 | 006201088918000000000000000000000000000019200489122448908184840824306080048A01C024801224489122420612102090C1820012240040C24306122601C0060000 |
---|
2070 | 00620108902800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000 |
---|
2071 | 00620108900800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000 |
---|
2072 | 0062010F100800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000 |
---|
2073 | 00620109110800000000000000000000000000001A2008112244811087E8840840FDF880089201C028802044891204421FA2102103F7E20022440043F44FDFA04601C0060000 |
---|
2074 | 00620108910800000000000000000000000000001A200811224481108428840840850880089201C0288020448912044210A210210214220022440042144850A04601C0060000 |
---|
2075 | 006201088908000000000000000000000000000019200409122440908424840820850880048A01C02480102448910242109210208214220012240042124850902601C0060000 |
---|
2076 | T 248 15 163 370.88232 70 554 34 T 1 db |
---|
2077 | 0062010F100800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000 |
---|
2078 | 00620109110800000000000000000000000000001A2008112244811087E8840840FDF880089201C028802044891204421FA2102103F7E20022440043F44FDFA04601C0060000 |
---|
2079 | 00620108910800000000000000000000000000001A200811224481108428840840850880089201C0288020448912044210A210210214220022440042144850A04601C0060000 |
---|
2080 | 006201088908000000000000000000000000000019200409122440908424840820850880048A01C02480102448910242109210208214220012240042124850902601C0060000 |
---|
2081 | 006201088708000000000000000000000000000018E003870E1C3870842384081C850880038601C023800E1C3870E1C2108E1020721422000E1C004211C8508E1E01C0060000 |
---|
2082 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2083 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2084 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2085 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2086 | 00620FEF071C000000000000000000000000000018E003870E1C3867F1C3BF8CFE3067F0038601C023800E1C3870E19FC70EFE33F8C19FC00E1C3BF8CFFFC60E1E01C0060000 |
---|
2087 | 006201088922000000000000000000000000000019200489122448608244840C10306080048A01C024801224489121820912103040C1820012244840C10206122601C0060000 |
---|
2088 | 00620108900200000000000000000000000000001A000810204080908408041210489080081201C02800204081020242102010484122420020408041210209204201C0060000 |
---|
2089 | 00620108900200000000000000000000000000001A000810204080908408041210489080081201C02800204081020242102010484122420020408041210209204201C0060000 |
---|
2090 | 0062010F100400000000000000000000000000001A000810204080908408041210489080081201C02800204081020242102010484122420020408041210209204201C0060000 |
---|
2091 | 00620109110800000000000000000000000000001A200811224481F88408843F10FDF880089201C028802044891207E2102210FC43F7E20022448043F1021FA04201C0060000 |
---|
2092 | 00620108911000000000000000000000000000001A200811224481088408842110850880089201C02880204489120422102210844214220022448042110210A04201C0060000 |
---|
2093 | 006201088920000000000000000000000000000019200409122441088204842110850880048A01C02480102448910422081210844214220012244042110210902201C0060000 |
---|
2094 | 00620108873E000000000000000000000000000018E003870E1C390881C3842110850880038601C023800E1C3870E422070E1084421422000E1C38421102108E1E01C0060000 |
---|
2095 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2096 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2097 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2098 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2099 | 00620FEF071C000000000000000000000000000018E003870E1C3067F183877F1C3077FFE38601C023800E1C3870C19FC60E1DFC70C1DFFF8E1C03F8C1C3070E1A01C0060000 |
---|
2100 | 006201088922000000000000000000000000000019200489122430608184890824309081048A01C0248012244890C1820612242090C2420412240040C24309121A01C0060000 |
---|
2101 | 00620108900200000000000000000000000000001A000810204048908248100840490081081201C02800204081012242092040210124020420400041240490202601C0060000 |
---|
2102 | 00620108900200000000000000000000000000001A000810204048908248100840490081081201C02800204081012242092040210124020420400041240490202601C0060000 |
---|
2103 | 0062010F100C00000000000000000000000000001A000810204048908248100840490081081201C02800204081012242092040210124020420400041240490202601C0060000 |
---|
2104 | 00620109110200000000000000000000000000001A2008112244FDF887E8900840FD1081089201C0288020448913F7E21FA2402103F4420422440043F44FD1207E01C0060000 |
---|
2105 | 00620108910200000000000000000000000000001A200811224485088428900840851081089201C0288020448912142210A240210214420422440042144851204201C0060000 |
---|
2106 | 006201088922000000000000000000000000000019200409122485088424880820849081048A01C02480102448921422109220208212420412240042124849104201C0060000 |
---|
2107 | 00620108871C000000000000000000000000000018E003870E1C8508842387081C847081038601C023800E1C38721422108E1C207211C2040E1C004211C8470E4201C0060000 |
---|
2108 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2109 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2110 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2111 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2112 | 00620FEF1108000000000000000000000000000018E1DFC70E1DFC67F183877F1C3077FFE38601C023877F1C3877F19FC60E1DFC70C1DFFF8E1C03F8C1C3070E1E01C0060000 |
---|
2113 | 006201089118000000000000000000000000000019224209122420608184890824309081048A01C024890824489081820612242090C2420412240040C24309122601C0060000 |
---|
2114 | 00620108912800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000 |
---|
2115 | T 248 15 163 385.90908 70 554 33 T 1 db |
---|
2116 | 006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000 |
---|
2117 | 00620FEF1108000000000000000000000000000018E1DFC70E1DFC67F183877F1C3077FFE38601C023877F1C3877F19FC60E1DFC70C1DFFF8E1C03F8C1C3070E1E01C0060000 |
---|
2118 | 006201089118000000000000000000000000000019224209122420608184890824309081048A01C024890824489081820612242090C2420412240040C24309122601C0060000 |
---|
2119 | 00620108912800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000 |
---|
2120 | 00620108910800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000 |
---|
2121 | 0062010F1F0800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000 |
---|
2122 | 00620109110800000000000000000000000000001A244211224021F887E8900840FD1081089201C028910844890087E21FA2402103F4420422440043F44FD1204201C0060000 |
---|
2123 | 00620108910800000000000000000000000000001A244211224021088428900840851081089201C0289108448900842210A240210214420422440042144851204201C0060000 |
---|
2124 | 006201089108000000000000000000000000000019224209122021088424880820849081048A0000248908244880842210922020821242041224004212484910220000060000 |
---|
2125 | 006201089108000000000000000000000000000018E1C2070E1C2108842387081C847081038600002387081C38708422108E1C207211C2040E1C004211C8470E1E0000060000 |
---|
2126 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2127 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2128 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2129 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2130 | 00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000 |
---|
2131 | 0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE3FFE3FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE3FFE060000 |
---|
2132 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2133 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2134 | 00600000000000000000000000000000000000000040000000000000000000000000000000020000010000000000000000000000000000000000000000000000020000060000 |
---|
2135 | 00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000 |
---|
2136 | 00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000 |
---|
2137 | 006000000000000000000000000000000000000000400C000020C040000000000000000000020000010030000083010000000000000000000000000000000000020000060000 |
---|
2138 | 006000000000000000000000000000000000000000401C000020E040000000000000000000020000010070000083810000000000000000000000000000000000020000060000 |
---|
2139 | 006000000000000000000000000000000000000000403C000020F0400000000000000000000200000100F0000083C10000000000000000000000000000000000020000060000 |
---|
2140 | 006000000000000000000000000000000000000000407C000020F85D5555555555555555540200000101F0000083E17FFFD55555555555555555555555555554020000060000 |
---|
2141 | 006000000000000000000000000000000000000000407C000020F85EAAAAAAAAAAAAAAAAAA0200000101F0000083E17FFFAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA020000060000 |
---|
2142 | 006000000000000000000000000000000000000000403C000020F05D5555555555555555540200000100F0000083C17FFFD55555555555555555555555555554020000060000 |
---|
2143 | 006000000000000000000000000000000000000000401C000020E040000000000000000000020000010070000083810000000000000000000000000000000000020000060000 |
---|
2144 | 006000000000000000000000000000000000000000400C000020C040000000000000000000020000010030000083010000000000000000000000000000000000020000060000 |
---|
2145 | 00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000 |
---|
2146 | 00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000 |
---|
2147 | 006000000000000000000000000000000000000007C7FFFFFFFFFFC00000000000000000003E00001F1FFFFFFFFFFF00000000000000000000000000000000003E0000060000 |
---|
2148 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2149 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2150 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2151 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2152 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2153 | T 248 15 163 400.88232 70 554 34 T 1 db |
---|
2154 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2155 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2156 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2157 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2158 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2159 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2160 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2161 | 00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2162 | 006000F0000000000780000000000000018000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000 |
---|
2163 | 006000C30000000021800000000F00000180C0003FCF818183E000000000000000000000000000000000000000000000000000000000000000000000001E00001E3F00060000 |
---|
2164 | 006000C30000000061800000001980000183C000060CC18783300000000000000000000000000000000000000000000000000000000000000000000000330000333F00060000 |
---|
2165 | 006000C31B0F8F1BF980D8787CD980F1E198C000060CC2C183300000000000000000000000000000000000000000000000000000000000000000000000330000030300060000 |
---|
2166 | 006000C31D98199B6180ECCCC0D9819B3198C000060C82C183200000000000000000000000000000000000000000000000000000000000000000000000330000030600060000 |
---|
2167 | 006000C3199C199C6180CCCCE01981833180C000060F04C183C000000000000000000000000000000000000000000000000000000000000000000000003303F8060600060000 |
---|
2168 | 000000C3198F1F986180CCCC781981833180C000060D87E1832000000000000000000000000000000000000000000000000000000000000000000000003300000C0C00000000 |
---|
2169 | 000400C3198398186180CCCC1C1981833180C000060D8C6183300000000000000000000000000000000000000000000000000000000000000000000000330000180C00020000 |
---|
2170 | 000400C3198198986180CCCC0CD9818B3198C000060CCC61833000000000000000000000000000000000000000000000000000000000000000000000003300003F1800020000 |
---|
2171 | 000400C3199F0F183980F878F8CF00F1E198C000060CEC6183E000000000000000000000000000000000000000000000000000000000000000000000001E00003F1800020000 |
---|
2172 | 000400F0000000000780C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
2173 | 00040000000000000000C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
2174 | 00040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
2175 | 00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
2176 | 00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000 |
---|
2177 | 00001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0020000 |
---|
2178 | 003FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF7FE0000 |
---|
2179 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2180 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2181 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2182 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2183 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2184 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2185 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2186 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2187 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2188 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2189 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2190 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2191 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2192 | 48 gr |
---|
2193 | 391.5 255.5 446.5 314.5 90 180 0 ar |
---|
2194 | 391.5 255.5 446.5 314.5 0 90 0 ar |
---|
2195 | 0 0 2 9 9 2 dh |
---|
2196 | 419 314 gm |
---|
2197 | 425 321 lin |
---|
2198 | rh |
---|
2199 | psb |
---|
2200 | pse |
---|
2201 | 0 0 2 9 9 2 dh |
---|
2202 | 419 314 gm |
---|
2203 | 425 307 lin |
---|
2204 | rh |
---|
2205 | psb |
---|
2206 | pse |
---|
2207 | 0 0 pen |
---|
2208 | 400 238 gm |
---|
2209 | 400 238 lin |
---|
2210 | nc ct 39 0 put |
---|
2211 | pr |
---|
2212 | 409 256 pl |
---|
2213 | 400 238 pl |
---|
2214 | 418 247 pl |
---|
2215 | 409 256 pl |
---|
2216 | 1 ep |
---|
2217 | 1 1 pen |
---|
2218 | 409 256 gm |
---|
2219 | bp |
---|
2220 | 400 238 T qi |
---|
2221 | 400 238 qc |
---|
2222 | 418 247 qc |
---|
2223 | 418 247 qc |
---|
2224 | 409 256 qc |
---|
2225 | 409 256 T qq |
---|
2226 | qf |
---|
2227 | qf |
---|
2228 | ef |
---|
2229 | 15 ec |
---|
2230 | (nc 294 162 447 412 6 rc)kp |
---|
2231 | 2 2 pen |
---|
2232 | 408 246 gm |
---|
2233 | 417 255 lin |
---|
2234 | 0 0 pen |
---|
2235 | 401 306 gm |
---|
2236 | 401 306 lin |
---|
2237 | nc ct 39 0 put |
---|
2238 | 0 gr |
---|
2239 | pr |
---|
2240 | 410 324 pl |
---|
2241 | 401 306 pl |
---|
2242 | 419 315 pl |
---|
2243 | 410 324 pl |
---|
2244 | 1 ep |
---|
2245 | 1 1 pen |
---|
2246 | 410 324 gm |
---|
2247 | bp |
---|
2248 | 401 306 T qi |
---|
2249 | 401 306 qc |
---|
2250 | 419 315 qc |
---|
2251 | 419 315 qc |
---|
2252 | 410 324 qc |
---|
2253 | 410 324 T qq |
---|
2254 | qf |
---|
2255 | qf |
---|
2256 | ef |
---|
2257 | 15 ec |
---|
2258 | (nc 294 162 447 412 6 rc)kp |
---|
2259 | 2 2 pen |
---|
2260 | 409 314 gm |
---|
2261 | 418 323 lin |
---|
2262 | 1 1 pen |
---|
2263 | 467 90 gm |
---|
2264 | (nc 31 30 761 582 6 rc)kp |
---|
2265 | 1 setTxMode |
---|
2266 | 2 F /|______Times-Roman fnt |
---|
2267 | 0.05432 0. 32 0.00543 0.(In order to split a window into two views, grab \(left button\) the left or right anchor \(small rectangle\) at)awidthshow |
---|
2268 | 478 90 gm |
---|
2269 | -0.02000 0.(either end of the horizontal scrollbar and drag to the middle of the window. This should split the window)ashow |
---|
2270 | 489 90 gm |
---|
2271 | 0.21789 0. 32 0.02178 0.(into two views. To join two views, place the mouse pointer on the horizontal scroll bar use the menu \(right)awidthshow |
---|
2272 | 500 90 gm |
---|
2273 | 0.61981 0. 32 0.06198 0.(button\) .)awidthshow |
---|
2274 | 522 90 gm |
---|
2275 | (The views are NOT two copies of the alignment. Changes in one window are reflected in the other. Users)show |
---|
2276 | 533 90 gm |
---|
2277 | 0.00976 0. 32 0.00097 0.(should not be confused by this fact.)awidthshow |
---|
2278 | 555 90 gm |
---|
2279 | 12 fz |
---|
2280 | 2 F /|______Times-Roman fnt |
---|
2281 | -0.06040 0.(Sequence Grouping)ashow |
---|
2282 | 578 90 gm |
---|
2283 | 10 fz |
---|
2284 | 2 F /|______Times-Roman fnt |
---|
2285 | -0.00846 0.(Sequences can be grouped for editing functions. This is very helpful when trying to adjust several sub)ashow |
---|
2286 | 589 90 gm |
---|
2287 | -0.00823 0.(alignments. When grouped, all sequences within a group will be affected by editing in any member of the)ashow |
---|
2288 | 600 90 gm |
---|
2289 | 0.07675 0. 32 0.00767 0.(group. All sequences within a group must have protections set to allow modification before any one will be)awidthshow |
---|
2290 | 611 90 gm |
---|
2291 | -0.20011 0.(modified.)ashow |
---|
2292 | 633 90 gm |
---|
2293 | -0.03013 0.(In order to group sequences, select the names of the sequences that should fall within a group, and select)ashow |
---|
2294 | 644 90 gm |
---|
2295 | -0.02406 0.(Group under the Edit menu. A number will be placed at the left of the sequence representing its assigned)ashow |
---|
2296 | 655 90 gm |
---|
2297 | -0.04641 0.(group number. To any sequence or sequences, the user selects those sequences and uses the Ungroup)ashow |
---|
2298 | 666 90 gm |
---|
2299 | -0.06661 0.(command under the Edit menu.)ashow |
---|
2300 | 688 90 gm |
---|
2301 | 12 fz |
---|
2302 | 2 F /|______Times-Roman fnt |
---|
2303 | -0.11912 0.(Special keys)ashow |
---|
2304 | F T cp |
---|
2305 | %%Page: ? 8 |
---|
2306 | op |
---|
2307 | 31 30 xl |
---|
2308 | 1 1 pen |
---|
2309 | 753 90 gm |
---|
2310 | (nc 31 30 761 582 6 rc)kp |
---|
2311 | 1 setTxMode |
---|
2312 | 0 fs |
---|
2313 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
2314 | 7 fz |
---|
2315 | 2 F /|______Times-Roman fnt |
---|
2316 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
2317 | 753 303 gm |
---|
2318 | 12 fz |
---|
2319 | 2 F /|______Times-Roman fnt |
---|
2320 | (8)show |
---|
2321 | 81 90 gm |
---|
2322 | 10 fz |
---|
2323 | 2 F /|______Times-Roman fnt |
---|
2324 | -0.01528 0.(There are also a few special function keys used in the GDE. Some functions have meta key equivalences so)ashow |
---|
2325 | 92 90 gm |
---|
2326 | -0.01637 0.(that they can be called from the keyboard, instead of by the menu system. The "meta" key is a standard)ashow |
---|
2327 | 103 90 gm |
---|
2328 | -0.05270 0.(property of X windows, and may be remapped to a different key symbol for different keyboards. For)ashow |
---|
2329 | 115 90 gm |
---|
2330 | 0.19775 0. 32 0.01977 0.(example, meta on Sun workstations is represented with a )awidthshow |
---|
2331 | {}mark T /Helvetica /|______Helvetica 0 rf |
---|
2332 | 9.35993 fz |
---|
2333 | 2 F /|______Helvetica fnt |
---|
2334 | 0.06533 0.(\340)ashow |
---|
2335 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
2336 | 10 fz |
---|
2337 | 2 F /|______Times-Roman fnt |
---|
2338 | 0.19256 0. 32 0.01925 0.(, where on a Macintosh running MacX it might)awidthshow |
---|
2339 | 126 90 gm |
---|
2340 | 0.13610 0. 32 0.01361 0.(be the "apple" key. The operation of the key is the same as the control or shift key, it is held down while)awidthshow |
---|
2341 | 137 90 gm |
---|
2342 | -0.04826 0.(pressing the second key in the sequence.)ashow |
---|
2343 | 159 90 gm |
---|
2344 | 0.07690 0. 32 0.00769 0.(Cut text, copy text and paste text are mapped to the Openlook equivalent keys \(L10, L6, and L8 on Sun)awidthshow |
---|
2345 | 170 90 gm |
---|
2346 | -0.03259 0.(keyboards\). Other meta keys are defined in the .GDEmenus file, and may be changed to suit your)ashow |
---|
2347 | 181 90 gm |
---|
2348 | -0.23315 0.(preferences.)ashow |
---|
2349 | 206 90 gm |
---|
2350 | 14 fz |
---|
2351 | 2 F /|______Times-Roman fnt |
---|
2352 | -0.01499 0.(Data Types)ashow |
---|
2353 | 229 90 gm |
---|
2354 | 10 fz |
---|
2355 | 2 F /|______Times-Roman fnt |
---|
2356 | 0.01342 0. 32 0.00134 0.(The GDE supports several data types. The data types supported in 2.2 are DNA, RNA, protein \(single letter)awidthshow |
---|
2357 | 240 90 gm |
---|
2358 | -0.08953 0.(codes\), mask sequence, and text.)ashow |
---|
2359 | 262 90 gm |
---|
2360 | 12 fz |
---|
2361 | 2 F /|______Times-Roman fnt |
---|
2362 | -0.16458 0.(DNA and RNA)ashow |
---|
2363 | 285 90 gm |
---|
2364 | 10 fz |
---|
2365 | 2 F /|______Times-Roman fnt |
---|
2366 | -0.06896 0.(Nucleic acid sequences are tightly type cast, and can contain any IUPAC code \(ACGTUM RSVWYHKDBN\))ashow |
---|
2367 | 296 90 gm |
---|
2368 | 0.00411 0. 32 0.00041 0.(as well as two alignment gap characters \('~' and '-'\). Some keys are remapped to fit IUPAC codes. For)awidthshow |
---|
2369 | 307 90 gm |
---|
2370 | 0.00274 0. 32 0.00027 0.(example, 'X' is mapped to 'N'. All nonstandard characters get mapped to the alignment gap '-'. Upper and)awidthshow |
---|
2371 | 318 90 gm |
---|
2372 | -0.06726 0.(lower case are both supported, and the T/U characters are mapped based on whether you are working with)ashow |
---|
2373 | 329 90 gm |
---|
2374 | -0.01962 0.(DNA or RNA. The color coding for DNA and RNA is identical. The color for ambiguous characters, and)ashow |
---|
2375 | 340 90 gm |
---|
2376 | 0.16555 0. 32 0.01655 0.(for alignment gaps is grey.)awidthshow |
---|
2377 | 362 90 gm |
---|
2378 | 12 fz |
---|
2379 | 2 F /|______Times-Roman fnt |
---|
2380 | -0.20167 0.(Amino Acid Sequence)ashow |
---|
2381 | 385 90 gm |
---|
2382 | 10 fz |
---|
2383 | 2 F /|______Times-Roman fnt |
---|
2384 | -0.04162 0.(Amino acid sequences are loosely type cast, and can contain any valid ASCII character. The results of)ashow |
---|
2385 | 396 90 gm |
---|
2386 | -0.09436 0.(analysis on nonstandard characters is not guaranteed. The color for nonstandard amino acid characters, and for)ashow |
---|
2387 | 407 90 gm |
---|
2388 | 0.24002 0. 32 0.02400 0.(alignment gaps is grey.)awidthshow |
---|
2389 | 429 90 gm |
---|
2390 | 12 fz |
---|
2391 | 2 F /|______Times-Roman fnt |
---|
2392 | -0.16378 0.(Text Sequence)ashow |
---|
2393 | 452 90 gm |
---|
2394 | 10 fz |
---|
2395 | 2 F /|______Times-Roman fnt |
---|
2396 | -0.03298 0.(Any valid ASCII printable character can be entered into a text sequence. Care should be taken with using)ashow |
---|
2397 | 463 90 gm |
---|
2398 | -0.00344 0.(space characters, as these will only be saved properly in Genbank format, and not in flat file format. The)ashow |
---|
2399 | 474 90 gm |
---|
2400 | -0.04928 0.(characters @#% and " should be avoided as well, as these can confuse the reading of flat files if saved in that)ashow |
---|
2401 | 485 90 gm |
---|
2402 | -0.02505 0.(format.)ashow |
---|
2403 | 507 90 gm |
---|
2404 | 12 fz |
---|
2405 | 2 F /|______Times-Roman fnt |
---|
2406 | -0.13627 0.(Mask Sequence)ashow |
---|
2407 | 530 90 gm |
---|
2408 | 10 fz |
---|
2409 | 2 F /|______Times-Roman fnt |
---|
2410 | -0.03303 0.(Mask sequence is identical to text sequence with the following exceptions. Mask sequence can have the)ashow |
---|
2411 | 541 90 gm |
---|
2412 | 0.06149 0. 32 0.00614 0.(ability \(function dependent\) of masking out positions in an alignment for analysis. If a mask sequence is)awidthshow |
---|
2413 | 552 90 gm |
---|
2414 | 0.01480 0. 32 0.00148 0.(selected along with some other sequence\(s\) for an analysis function that permits masking, then all columns)awidthshow |
---|
2415 | 563 90 gm |
---|
2416 | 0.06927 0. 32 0.00692 0.(that contain a '0' in the mask sequence will be ignored by the function. The mask itself would not be passed)awidthshow |
---|
2417 | 574 90 gm |
---|
2418 | 0.22354 0. 32 0.02235 0.(to the analysis function either. Some functions allow masking, some do not. Refer to the instruction page)awidthshow |
---|
2419 | 585 90 gm |
---|
2420 | -0.00167 0.(for each function to see whether or not it supports sequence masking.)ashow |
---|
2421 | 607 90 gm |
---|
2422 | 12 fz |
---|
2423 | 2 F /|______Times-Roman fnt |
---|
2424 | -0.06585 0.(Color Masks)ashow |
---|
2425 | 630 90 gm |
---|
2426 | 10 fz |
---|
2427 | 2 F /|______Times-Roman fnt |
---|
2428 | 0.01022 0. 32 0.00102 0.(Color masks give color to a sequence on a position by position basis. Individual sequences can have color)awidthshow |
---|
2429 | 641 90 gm |
---|
2430 | -0.01266 0.(masks attached to them, or one color mask can be used for an entire alignment. Color masks are generated)ashow |
---|
2431 | 652 90 gm |
---|
2432 | -0.00192 0.(externally by some analysis functions, and are then passed back to the GDE. The file format for a colormask)ashow |
---|
2433 | 663 90 gm |
---|
2434 | -0.07350 0.(is described in Appendix A.)ashow |
---|
2435 | 699 90 gm |
---|
2436 | 14 fz |
---|
2437 | 2 F /|______Times-Roman fnt |
---|
2438 | 0.15777 0. 32 0.01577 0.(Menu Functions: File menu)awidthshow |
---|
2439 | F T cp |
---|
2440 | %%Page: ? 9 |
---|
2441 | op |
---|
2442 | 31 30 xl |
---|
2443 | 1 1 pen |
---|
2444 | 753 90 gm |
---|
2445 | (nc 31 30 761 582 6 rc)kp |
---|
2446 | 1 setTxMode |
---|
2447 | 0 fs |
---|
2448 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
2449 | 7 fz |
---|
2450 | 2 F /|______Times-Roman fnt |
---|
2451 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
2452 | 753 303 gm |
---|
2453 | 12 fz |
---|
2454 | 2 F /|______Times-Roman fnt |
---|
2455 | (9)show |
---|
2456 | 81 90 gm |
---|
2457 | 10 fz |
---|
2458 | 2 F /|______Times-Roman fnt |
---|
2459 | -0.00126 0.(The GDE has several built-in menu functions under the File and Edit menus. These functions are unique in)ashow |
---|
2460 | 92 90 gm |
---|
2461 | -0.02758 0.(that they are part of the primary display editor, and are not described in the .GDEmenus file.)ashow |
---|
2462 | 115 90 gm |
---|
2463 | 12 fz |
---|
2464 | 2 F /|______Times-Roman fnt |
---|
2465 | 0.33511 0.(Open...)ashow |
---|
2466 | 127 90 gm |
---|
2467 | 10 fz |
---|
2468 | 2 F /|______Times-Roman fnt |
---|
2469 | 0.19515 0. 32 0.01951 0.(Selecting this will bring up the open file dialog box. Users can scroll through a list of files in the current)awidthshow |
---|
2470 | 138 90 gm |
---|
2471 | -0.07145 0.(directory, move up and down the directory tree, and open any individual data file. The sequence data in that)ashow |
---|
2472 | 149 90 gm |
---|
2473 | -0.02137 0.(file is loaded into the current editing window below any existing sequences. The open command will open)ashow |
---|
2474 | 160 90 gm |
---|
2475 | -0.01487 0.(any Genbank formatted file, or a GDE flat file.)ashow |
---|
2476 | 182 90 gm |
---|
2477 | 12 fz |
---|
2478 | 2 F /|______Times-Roman fnt |
---|
2479 | 1.41235 0. 32 0.14123 0.(Save as...)awidthshow |
---|
2480 | 194 90 gm |
---|
2481 | 10 fz |
---|
2482 | 2 F /|______Times-Roman fnt |
---|
2483 | 0.07537 0. 32 0.00753 0.(This function will save the entire alignment to a specified file in either Genbank or flat file format. The file)awidthshow |
---|
2484 | 205 90 gm |
---|
2485 | -0.00964 0.(will be saved in the local directory unless a relative or absolute path is specified.)ashow |
---|
2486 | 227 90 gm |
---|
2487 | 12 fz |
---|
2488 | 2 F /|______Times-Roman fnt |
---|
2489 | 0.19628 0.(Properties...)ashow |
---|
2490 | 239 90 gm |
---|
2491 | 10 fz |
---|
2492 | 2 F /|______Times-Roman fnt |
---|
2493 | 0.02334 0. 32 0.00233 0.(Properties controls the display settings. Those settings include character size, color type, and insert)awidthshow |
---|
2494 | 250 90 gm |
---|
2495 | -0.07415 0.(direction. The screen can also be inverted, vertical scroll lock and keyboard clicks \(tactile feedback\) can be)ashow |
---|
2496 | 261 90 gm |
---|
2497 | 0.11657 0. 32 0.01165 0.(turned on or off. Vertical scrollbar lock will cause all split views to scroll together in the vertical)awidthshow |
---|
2498 | 272 90 gm |
---|
2499 | -0.11550 0.(direction.)ashow |
---|
2500 | 0 0 gm |
---|
2501 | (nc 274 234 409 370 6 rc)kp |
---|
2502 | 64 gr |
---|
2503 | 275 235 408 369 1 rc |
---|
2504 | T 134 33.87997 235 275 40 305 77 T 1 db |
---|
2505 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2506 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2507 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000 |
---|
2508 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000 |
---|
2509 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2510 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2511 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2512 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2513 | C0000004000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2514 | C0000004000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2515 | C0000004000000000000000000000000000000000000018000000000000000000000000000018000 |
---|
2516 | C0003F8400000000000000000000000007C000000000218000000000000000000000000000018000 |
---|
2517 | C0002004000000000000000000000000066000000000600000000000000000000000000000018000 |
---|
2518 | C0001004000000000000000000000000066D9E1B0F1BF98F0F800000000000000000000000018000 |
---|
2519 | C0001004000000000000000000000000066DB31D999B619998000000000000000000000000018000 |
---|
2520 | C0000804000000000000000000000000064E3319999C61999C000000000000000000000000018000 |
---|
2521 | C0000804000000000000000000000000078C33199F98619F8F000000000000000000000000018000 |
---|
2522 | C0000004000000000000000000000000060C33199818619803800000000000000000000000018000 |
---|
2523 | C0000004000000000000000000000000060C33199898619881800000000000000000000000018000 |
---|
2524 | C0000004000000000000000000000000060C1E1F0F18398F1F000000000000000000000000018000 |
---|
2525 | C0000004000000000000000000000000000000180000000000000000000000000000000000018000 |
---|
2526 | C001FFF8000000000000000000000000000000180000000000000000000000000000000000018000 |
---|
2527 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2528 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2529 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2530 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2531 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2532 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2533 | C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF18000 |
---|
2534 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2535 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2536 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2537 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2538 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2539 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2540 | C0000000004000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2541 | C0000782102000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2542 | C0000842202000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2543 | C0001022401000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2544 | C0001022801000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2545 | C0001023801000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2546 | C0001022401000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2547 | C0001022201000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2548 | C0000842101000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2549 | C0000782101000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2550 | C0000000002000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2551 | C0000000002000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2552 | C0000000004000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2553 | C0080000008000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2554 | C0060000030000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2555 | C001FFFFFC0000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2556 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2557 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2558 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2559 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2560 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2561 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2562 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2563 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2564 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2565 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2566 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2567 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2568 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2569 | C000000C000000000000000000000000000000000000000000000000060000000000000000018000 |
---|
2570 | C007800C000010000000000000000000000000000000000FC0000807860000000000000000018000 |
---|
2571 | C00CC00C000030000000000000000000000000000000000C0000180CC00000000000000000018000 |
---|
2572 | C0180F0C78D87D8CD878000000000000000000000000000C1E1B3E0C067C78000000000000018000 |
---|
2573 | C018198CCCD8318CECCC000000000000000000000000000C331D980E060CCC000000000000018000 |
---|
2574 | C018198CCCE03188CCCC000000000000000000000000000FB31998078618CC000000000000018000 |
---|
2575 | C018198CCCC030D8CCFC000000000000000000000000000C33199801C638FC000000000000018000 |
---|
2576 | C018198CCCC030D0CCC0000000000000000000000000000C33199800C630C0000000000000018000 |
---|
2577 | C00C598CCCC03070CCC4000000000000000000000000000C3319980CC660C4000000000000018000 |
---|
2578 | C0078F0C78C01C60F878000000000000000000000000000C1E198E07867C78000000000000018000 |
---|
2579 | C0000000000000C0C000000000000000000000000000000000000000000000000000000000018000 |
---|
2580 | C0000000000000C0C000000000000000000000000000000000000000000000000000000000018000 |
---|
2581 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2582 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2583 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2584 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2585 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2586 | T 134 33 235 308.86840 40 305 76 T 1 db |
---|
2587 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2588 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2589 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2590 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2591 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2592 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2593 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2594 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2595 | C0000080000000000000000000000000000000000000000000400000000000000000000000018000 |
---|
2596 | C0000080000080000000000000000001000000000000000000400000000220000000000000018000 |
---|
2597 | C000008000F080000000400000000001000000000000000000400082000220000000000000018000 |
---|
2598 | C007F0800108800000004000006000010000000000000003F84000C6000200000000000000018000 |
---|
2599 | C00400800200B0E2CE0EF38B00181C610C58000000000002004000C61C1E2222CC00000000018000 |
---|
2600 | C00200800200C9131110444C000420911260000000000001004000AA222222233200000000018000 |
---|
2601 | C002008002008812012044487F0241092140000000000001004000AA222222222200000000018000 |
---|
2602 | C0010080020088F20F2047C8000441092140000000000000804000923E2222222200000000018000 |
---|
2603 | C0010080020089121120440800184109214000000000000080400092202222222200000000018000 |
---|
2604 | C0000080010889121110444800602091124000000000000000400082222622622200000000018000 |
---|
2605 | C000008000F088EA0E8E338800001C610C40000000000000004000821C1A21A22200000000018000 |
---|
2606 | C0000080000000000000000000000000000000000000000000400000000000000000000000018000 |
---|
2607 | C0000080000000000000000000000000000000000000000000400000000000000000000000018000 |
---|
2608 | C03FFF00000000000000000000000000000000000000001FFF800000000000000000000000018000 |
---|
2609 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2610 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2611 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2612 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2613 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2614 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2615 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2616 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2617 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2618 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2619 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2620 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2621 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2622 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2623 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2624 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2625 | C00000000000000000000000001FFFFFFFFFFFF80000000000002000000000000000000000018000 |
---|
2626 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2627 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2628 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2629 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2630 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2631 | C0000318060000000000018000100000000000000000800004002000000000000000000000018000 |
---|
2632 | C01F83188600000000000180001008000000200000F0800004002000000000000000000000018000 |
---|
2633 | C0180301800000000000018000100800000020000108800004002000000000000000000000018000 |
---|
2634 | C0181F1BE6361F01B30F0F8F001008B0E38B78000200B0E0E4402000000000000000000000018000 |
---|
2635 | C0183319863B3301DD999999801008C9044C20000200C91104802000000000000000000000018000 |
---|
2636 | C01F3319863333019999999980100889044820000200891205002000000000000000000000018000 |
---|
2637 | C0183319863333019999999F80100888C7C82000020089F207002000000000000000000000018000 |
---|
2638 | C0183319863337019999999800100888240820000200890204802000000000000000000000018000 |
---|
2639 | C018371986331B0199999B9880100888244820000108891104C02000000000000000000000018000 |
---|
2640 | C01F9B18E6330301998F0D8F00100889C388180000F088E0E4402000000000000000000000018000 |
---|
2641 | C0000000000033000000000000100000000000000000000000002000000000000000000000018000 |
---|
2642 | C000000000001E000000000000100000000000000000000000002000000000000000000000018000 |
---|
2643 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2644 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2645 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2646 | C0000000000000000000000000100000000000000000000000002000000000000000000000018000 |
---|
2647 | C000000000000000000000000010000000000001FFFFFFFFFFFFE000000000000000000000018000 |
---|
2648 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2649 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2650 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2651 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2652 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2653 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2654 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2655 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2656 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2657 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2658 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2659 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2660 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2661 | C0000000000000000000000000000000000000000000000000030000000000000000000000018000 |
---|
2662 | C0000000000000000000000000000000000000000600000000430000000000000000000000018000 |
---|
2663 | C0000000000000000000000000000000000000000600000000C00000000000000000000000018000 |
---|
2664 | C00000000000000000000000000000000000000006361F1E37F31E1B000000000000000000018000 |
---|
2665 | C000000000000000000000000000000000000000063B303336C3331D800000000000000000018000 |
---|
2666 | C0000400000000000000080000000000000000000633383338C33319800000000000000000018000 |
---|
2667 | T 134 33 235 341.86840 40 305 76 T 1 db |
---|
2668 | C0000000000000000000000000000000000000000600000000C00000000000000000000000018000 |
---|
2669 | C00000000000000000000000000000000000000006361F1E37F31E1B000000000000000000018000 |
---|
2670 | C000000000000000000000000000000000000000063B303336C3331D800000000000000000018000 |
---|
2671 | C0000400000000000000080000000000000000000633383338C33319800000000000000000018000 |
---|
2672 | C00004000400000008000800000000000000000006331E3F30C33319800000000000000000018000 |
---|
2673 | C0000400040000000800080000000000000000000633073030C33319800000000000000000018000 |
---|
2674 | C0000400045888E2DE70780000000000000000000633033130C33319800000000000000000018000 |
---|
2675 | C00004000464891308888800000000000000000006333E1E30731E19800000000000000000018000 |
---|
2676 | C0000400044489120888880000000000000000000000000000000000000000000000000000018000 |
---|
2677 | C0000400044451F208F8880000000000000000000000000000000000000000000000000000018000 |
---|
2678 | C0000400044451020880880000000000000000000000000000000000000000000000000000018000 |
---|
2679 | C0000400044421120888980000000000000000000000000000000000000000000000000000018000 |
---|
2680 | C0000400044420E20670680000000000000000000000000000000000000000000000000000018000 |
---|
2681 | C0000400000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2682 | C03FFC00000000000000000000000000000000000000000000000000000000000010000000018000 |
---|
2683 | C0000000000000000000000000000000000000000000000000000000000000000010000000018000 |
---|
2684 | C0000000000000000000000000000000000000000000000000000000000000000010000000018000 |
---|
2685 | C0000000000000000000000000000000000000000000000000000000000000000010000000018000 |
---|
2686 | C0000000000000000000000000000000000000000000000000000000000000000010000000018000 |
---|
2687 | C0000000000000000000000000000000000000000000000000000000000000000010000000018000 |
---|
2688 | C00000000000000000000000000000000000000000000801000000C0000000000010000000018000 |
---|
2689 | C000000000000000000000000000000000000000000F080101000100000000000010000000018000 |
---|
2690 | C0000000000000000000000000000000000000000008800101000100000000000010000000018000 |
---|
2691 | C000000000000000000000000000000000000000000888F163C063C072259C316010000000018000 |
---|
2692 | C0000000000000000000000000000000000000000008891191009100822620498010000000018000 |
---|
2693 | C000000000000000000000000000000000000000000F091111010901022420850010000000018000 |
---|
2694 | C0000000000000000000000000000000000000000009091111010901022418850010000000018000 |
---|
2695 | C0000000000000000000000000000000000000000008893111010901022404850010000000018000 |
---|
2696 | C000000000000000000000000000000000000000000888D111009100826404490010000000018000 |
---|
2697 | C0000000000000000000000000000000000000000008881110C0610071A438310010000000018000 |
---|
2698 | C0000000000000000000000000000000000000000000001000000000000000000010000000018000 |
---|
2699 | C000000000000000000000000000000000000000000000E000000000000000000010000000018000 |
---|
2700 | C0000400000000800000001000080000000880000000000000000000000000000010000000018000 |
---|
2701 | C0000400040000800000021000080000000880000000000000000000000000000010000000018000 |
---|
2702 | C0000400040000800000020000080000000880000000000000000000000000000010000000018000 |
---|
2703 | C0000400040C1C882238B790E7080E1D630880000000000000000000000000000010000000018000 |
---|
2704 | C0000400041220902244C21108881021848880000FFFFFFFFFFFFFFFFFFFFFFFFFF0000000018000 |
---|
2705 | C0000400042140A02244821200881041084880001FFFFFFFFFFFFFFFFFFFFFFFFFE0000000018000 |
---|
2706 | C0000400042140E0147C821207880C41084880001000000000000000000000000000000000018000 |
---|
2707 | C0000400042140901440821208880241084880001000000000000000000000000000000000018000 |
---|
2708 | C0000400041220980844821108880221048880001000000000000000000000000000000000018000 |
---|
2709 | C0000400078C1C8808388190E7481C1D030880001000000000000000000000000000000000018000 |
---|
2710 | C0000400000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2711 | C03FFC00000000000000000000000000000000001000003000018000000000000000000000018000 |
---|
2712 | C0000000000000000000000000000000000000001008004200020000000000000000000000018000 |
---|
2713 | C0000000000000000000000000000000000000001008004200020000000000000000000000018000 |
---|
2714 | C000000000000000000000000000000000000000100838F780C780E44B3862C00000000000018000 |
---|
2715 | C00000000000000000000000000000000000000010084442012201044C4093000000000000018000 |
---|
2716 | C000000000000000000000000000000000000000100844420212020448410A000000000000018000 |
---|
2717 | C00000000000000000000000000000000000000010087C420212020448310A000000000000018000 |
---|
2718 | C000000000000000000000000000000000000000100840420212020448090A000000000000018000 |
---|
2719 | C0000000000000000000000000000000000000001008444201220104C80892000000000000018000 |
---|
2720 | C000000000000000000000000000000000000000100F384180C200E3487062000000000000018000 |
---|
2721 | C0000000000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2722 | C0000000000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2723 | C0000000000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2724 | C0000000000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2725 | C0000000000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2726 | C0000000000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2727 | C0000000000000000000000000000000000000001000000000000000000000000000000000018000 |
---|
2728 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2729 | C0000400000000000440100000000000000000000000000000000000000000000000000000018000 |
---|
2730 | C0000400042000000440100000000000000000000000000000000000000000000000000000018000 |
---|
2731 | C0000400044000000400100000000000000000000000000000000000000000000000000000018000 |
---|
2732 | C000040004871100E443913800000000000000000000000000000000000000000000000000018000 |
---|
2733 | C0000400050891010444124000000000000000000000000000000000000000000000000000018000 |
---|
2734 | C0000400070891020448144000000000000000000000000000000000000000000000000000018000 |
---|
2735 | C0000400048F8A0204481C3000000000000000000000000000000000000000000000000000018000 |
---|
2736 | C000040004480A020448120800000000000000000000000000000000000000000000000000018000 |
---|
2737 | C0000400042884010444130800000000000000000000000000000000000000000000000000018000 |
---|
2738 | C000040004270400E443917000000000000000000000000000000000000000000000000000018000 |
---|
2739 | C0000400000008000000000000000000000000000000000000000000000000000000000000018000 |
---|
2740 | C03FFC00000018000000000000000000000000000000000000000000000000000000000000018000 |
---|
2741 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2742 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2743 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2744 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2745 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2746 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2747 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2748 | T 134 34 235 374.89471 40 305 76 T 1 db |
---|
2749 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2750 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2751 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2752 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2753 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2754 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2755 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2756 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2757 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2758 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2759 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2760 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2761 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2762 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2763 | C0000400000000000000000000000020000000000000000000000000000000000000000000018000 |
---|
2764 | C0000400041000000000000000000020000000000000000000000000000000000000000000018000 |
---|
2765 | C0000400063000000000000000000020000000000000000000000000000000000000000000018000 |
---|
2766 | C00004000630E1C71C3C700B0E161C20000000000000000000000000000000000000000000018000 |
---|
2767 | C0000400055112082244880C91192220000000000000000000000000000000000000000000018000 |
---|
2768 | C0000400055112080244880881112220000000000000000000000000000000000000000000018000 |
---|
2769 | C00004000491F1861E44F8088F113E20000000000000000000000000000000000000000000018000 |
---|
2770 | C000040004910041224C800891112020000000000000000000000000000000000000000000018000 |
---|
2771 | C0000400041110412234880891112220000000000000000000000000000000000000000000018000 |
---|
2772 | C00004000410E38E1D04700F0E911C20000000000000000000000000000000000000000000018000 |
---|
2773 | C0000400000000000004000800000000000000000000000000000000000000000000000000018000 |
---|
2774 | C03FFC00000000000038000800000000000000000000000000000000000000000000000000018000 |
---|
2775 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2776 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2777 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2778 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2779 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2780 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2781 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2782 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2783 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2784 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2785 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2786 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2787 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2788 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2789 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2790 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2791 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2792 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2793 | C0000000300000000000000000000000400000000000000000000000000000000000000000018000 |
---|
2794 | C01E000030000020000000000200000040000000000000000000000000003C180000000000018000 |
---|
2795 | C0330000300000E0000000000E000000400000000000000000000000000042240000000000018000 |
---|
2796 | C0301E3C31E300200000000002000000400000000000000000000000000002420000000000018000 |
---|
2797 | C03833663333002000000000020000007FFFFFFFFFFFFFFFFFFFFFFFF80002420000000000018000 |
---|
2798 | C01E3006333000200000000002000000400000000000000000000000000004420000000000018000 |
---|
2799 | C007303E33F000200000000002000000400000000000000000000000000008420000000000018000 |
---|
2800 | C0033066330000200000000002000000400000000000000000000000000010420000000000018000 |
---|
2801 | C0333166331300220000000002000000400000000000000000000000000020240000000000018000 |
---|
2802 | C01E1E3B31E30025000000000200000040000000000000000000000000007E180000000000018000 |
---|
2803 | C00000000000000A8000000000000000400000000000000000000000000000000000000000018000 |
---|
2804 | C0000000000000154000000000000000400000000000000000000000000000000000000000018000 |
---|
2805 | C00000000000000A800000100000007F800000000000000000000000000000000000000000018000 |
---|
2806 | C0000000000001FFFFFFFFF000000000000000000000000000000000000000000000000000018000 |
---|
2807 | C0000000000000020000000000000000000000000000000000000000000000000000000000018000 |
---|
2808 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2809 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2810 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2811 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2812 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2813 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2814 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2815 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2816 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2817 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2818 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2819 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2820 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2821 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2822 | C0000000000000000000000000000000000000000000000000000000000000000000000000018000 |
---|
2823 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000 |
---|
2824 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000 |
---|
2825 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2826 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2827 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2828 | 00000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
2829 | 451 90 gm |
---|
2830 | (nc 31 30 761 582 6 rc)kp |
---|
2831 | 1 setTxMode |
---|
2832 | 12 fz |
---|
2833 | 2 F /|______Times-Roman fnt |
---|
2834 | 0.15495 0.(Protections...)ashow |
---|
2835 | 463 90 gm |
---|
2836 | 10 fz |
---|
2837 | 2 F /|______Times-Roman fnt |
---|
2838 | -0.01272 0.(This will display, and then set the default protections for all selected sequences. If two or more of the)ashow |
---|
2839 | 474 90 gm |
---|
2840 | -0.02812 0.(sequences differ in their current protection settings, a warning message will appear in the protection dialog)ashow |
---|
2841 | 485 90 gm |
---|
2842 | -0.00859 0.(box. The protections currently available are alignment gap protection, ambiguous character protection,)ashow |
---|
2843 | 496 90 gm |
---|
2844 | -0.02893 0.(unambiguous character protection, and translation protection.)ashow |
---|
2845 | 0 0 gm |
---|
2846 | (nc 498 270 578 352 6 rc)kp |
---|
2847 | 64 gr |
---|
2848 | 499 271 577 351 1 rc |
---|
2849 | T 80 39.75726 271 499 28 210 105 T 1 db |
---|
2850 | 00000000000000000000000000000000000000000000000000000000 |
---|
2851 | 00000000000000000000000000000000000000000000000000000000 |
---|
2852 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000 |
---|
2853 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000 |
---|
2854 | C000000000000000000000000000000000000000000000000000C000 |
---|
2855 | C000000000000000000000000000000000000000000000000000C000 |
---|
2856 | C000000000000000000000000000000000000000000000000000C000 |
---|
2857 | C000000000000000000000000000000000000000000000000000C000 |
---|
2858 | C000000400000000000000000000000000000000000000000000C000 |
---|
2859 | C000000400000000000000000000000000000000000000000000C000 |
---|
2860 | C000000400000000000000000000000000030000000000000000C000 |
---|
2861 | C0003F840000000003C00201F000040000430000000000000000C000 |
---|
2862 | C0002004000000000660060198000C0000C00000000000000000C000 |
---|
2863 | C0001004000000000603CF819B679F3C3DF31E1B0F8000000000C000 |
---|
2864 | C000100400000000070666019B6CCC6666C3331D980000000000C000 |
---|
2865 | C00008040000000003C66601938CCC6660C333199C0000000000C000 |
---|
2866 | C00008040000000000E7E601E30CCC7E60C333198F0000000000C000 |
---|
2867 | C00000040000000000660601830CCC6060C33319838000000000C000 |
---|
2868 | C00000040000000006662601830CCC6262C33319818000000000C000 |
---|
2869 | C00000040000000003C3C3818307873C3C731E199F0000000000C000 |
---|
2870 | C000000400000000000000000000000000000000000000000000C000 |
---|
2871 | C001FFF800000000000000000000000000000000000000000000C000 |
---|
2872 | C000000000000000000000000000000000000000000000000000C000 |
---|
2873 | C000000000000000000000000000000000000000000000000000C000 |
---|
2874 | C000000000000000000000000000000000000000000000000000C000 |
---|
2875 | C000000000000000000000000000000000000000000000000000C000 |
---|
2876 | C000000000000000000000000000000000000000000000000000C000 |
---|
2877 | C000000000000000000000000000000000000000000000000000C000 |
---|
2878 | C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8C000 |
---|
2879 | C000000000000000000000000000000000000000000000000000C000 |
---|
2880 | C000000000000000000000000000000000000000000000000000C000 |
---|
2881 | C000000000000000000000000000000000000000000000000000C000 |
---|
2882 | C000000000000000000000000000000000000000000000000000C000 |
---|
2883 | C000000000000000000000000000000000000000000000000000C000 |
---|
2884 | C000000000000000000000000000000000000000000000000000C000 |
---|
2885 | C000000000000200000000000000000000000000000000000000C000 |
---|
2886 | C0001F0000000100000000000000000000000000000000000000C000 |
---|
2887 | C000108000000100000000000000000000000000000000000000C000 |
---|
2888 | C00010430B0E0080000000000000000000000000000000000000C000 |
---|
2889 | C00010448C910080000000000000000000000000000000000000C000 |
---|
2890 | C000104848910080000000000000000000000000000000000000C000 |
---|
2891 | C0001048489F0080000000000000000000000000000000000000C000 |
---|
2892 | C000104848900080000000000000000000000000000000000000C000 |
---|
2893 | C000108488910080000000000000000000000000000000000000C000 |
---|
2894 | C0001F03088E0080000000000000000000000000000000000000C000 |
---|
2895 | C000000000000100000000000000000000000000000000000000C000 |
---|
2896 | C000000000000100000000000000000000000000000000000000C000 |
---|
2897 | C000000000000200000000000000000000000000000000000000C000 |
---|
2898 | C008000000000400000000000000000000000000000000000000C000 |
---|
2899 | C006000000001800000000000000000000000000000000000000C000 |
---|
2900 | C001FFFFFFFFE000000000000000000000000000000000000000C000 |
---|
2901 | C000000000000000000000000000000000000000000000000000C000 |
---|
2902 | C000000000000000000000000000000000000000000000000000C000 |
---|
2903 | C000000000000000000000000000000000000000000000000000C000 |
---|
2904 | C000000000000000000000000000000000000000000000000000C000 |
---|
2905 | C000000000000000000000000000000000000000000000000000C000 |
---|
2906 | C000000000000000000000000000000000000000000000000000C000 |
---|
2907 | C000000000000000000000000000000000000000000000000000C000 |
---|
2908 | C000000000000000000000000000000000000000000000000000C000 |
---|
2909 | C000000000000000000000000000000000000000000000000000C000 |
---|
2910 | C000000000000000000000000000000000000000000000000000C000 |
---|
2911 | C000000000000000000000000000000000000000000000000000C000 |
---|
2912 | C000000000000000000000000000000000000000000000000000C000 |
---|
2913 | C000000000000000000000000000000000000000000000000000C000 |
---|
2914 | C0000C600000000C0000000630E6000003000000000000000000C000 |
---|
2915 | C0060C600000000C000000063186000043000000000000000000C000 |
---|
2916 | C0060C600000000C0000000601800000C0000000000000000000C000 |
---|
2917 | C00B0C63C606787C06CC3C3E33E63C79F31E1B0F980000000000C000 |
---|
2918 | C00B0C666666CCCC07766666318666CCC3331D98180000000000C000 |
---|
2919 | C0130C66636CCCCC066666663186600CC333199C000000000000C000 |
---|
2920 | C01F8C66636CFCCC066666663186607CC333198F000000000000C000 |
---|
2921 | C0318C6663FCC0CC06666666318660CCC3331983800000000000C000 |
---|
2922 | C0318C666198C4DC0666666E318662CCC3331981980000000000C000 |
---|
2923 | C0318C63C198786C06663C3631863C76731E199F180000000000C000 |
---|
2924 | C000000000000000000000000000000000000000000000000000C000 |
---|
2925 | C000000000000000000000000000000000000000000000000000C000 |
---|
2926 | C000000000000000000000000000000000000000000000000000C000 |
---|
2927 | C000000000000000000000000000000000000000000000000000C000 |
---|
2928 | C000000000000000000000000000000000000000000000000000C000 |
---|
2929 | C000000000000000000000000000000000000000000000000000C000 |
---|
2930 | C000000000000000000000000000000000000000000000000000C000 |
---|
2931 | C000000000000000000000000000000000000000000000000000C000 |
---|
2932 | C000000000000000000000000000000000000000000000000000C000 |
---|
2933 | C000000000000000000000000000000000000000000000000000C000 |
---|
2934 | C000000000000000000000000000000000000000000000000000C000 |
---|
2935 | C000000000000000000000000000000000000000000000000000C000 |
---|
2936 | C000040000000000008080000000000020000000000000000000C000 |
---|
2937 | C000040000000000008080000000000020000000100000000000C000 |
---|
2938 | C000040000000000008000000000000020000000100000000000C000 |
---|
2939 | C00004000445870B30B08F110C2238072C38B383BCE2CE000000C000 |
---|
2940 | C00004000446488CC8C89111122240083244C444111310000000C000 |
---|
2941 | C000040004444088888891112122401022048048111210000000C000 |
---|
2942 | C0000400044447888888911121223010223C83C811F20C000000C000 |
---|
2943 | C000040004444888888893112122081022448448110202000000C000 |
---|
2944 | C000040004C4488888888D131226080822448444111202000000C000 |
---|
2945 | C00004000344474888F0810D0C1A7007223A83A38CE21C000000C000 |
---|
2946 | C000040000000000000001000000000000000000000000000000C000 |
---|
2947 | C03FFC000000000000000E000000000000000000000000000000C000 |
---|
2948 | C000000000000000000000000000000000000000000000000000C000 |
---|
2949 | C000000000000000000000000000000000000000000000000000C000 |
---|
2950 | C000000000000000000000000000000000000000000000000000C000 |
---|
2951 | C000000000000000000000000000000000000000000000000000C000 |
---|
2952 | C000000000000000000000000000000000000000000000000000C000 |
---|
2953 | C000000000000000000000000000000000000000000000000000C000 |
---|
2954 | C000000000000000000000000000000000000000000000000000C000 |
---|
2955 | C000000000000000000000000000000000000000000000000000C000 |
---|
2956 | C000000000000000000000000000000000000000000000000000C000 |
---|
2957 | C000000000000000000000000000000000000000000000000000C000 |
---|
2958 | C000000000000000000000000000000000000000000000000000C000 |
---|
2959 | T 80 39 271 538.75726 28 210 103 T 1 db |
---|
2960 | C000000000000000000000000000000000000000000000000000C000 |
---|
2961 | C000000000000000000000000000000000000000000000000000C000 |
---|
2962 | C000000000000000000000000000000000000000000000000000C000 |
---|
2963 | C000000000000000000000000000000000000000000000000000C000 |
---|
2964 | C000000000000000000000000000000000000000000000000000C000 |
---|
2965 | C000000000000000000000000000000000000000000000000000C000 |
---|
2966 | C000000000000000000000000000000000000000000000000000C000 |
---|
2967 | C000000000000000000000000000000000000000000000000000C000 |
---|
2968 | C000000000000000000000000000000000000000000000000000C000 |
---|
2969 | C000000000000000000000000000000000000000000000000000C000 |
---|
2970 | C000040000000080800000000000200000000000000000000000C000 |
---|
2971 | C000040000000080800000000000200000001000000000000000C000 |
---|
2972 | C000040000000080000000000000200000001000000000000000C000 |
---|
2973 | C0000400070B30B08F110C2238072C38B383BCE2CE0000000000C000 |
---|
2974 | C0000400088CC8C89111122240083244C4441113100000000000C000 |
---|
2975 | C000040000888888911121224010220480481112100000000000C000 |
---|
2976 | C000040007888888911121223010223C83C811F20C0000000000C000 |
---|
2977 | C000040008888888931121220810224484481102020000000000C000 |
---|
2978 | C0000400088888888D1312260808224484441112020000000000C000 |
---|
2979 | C0000400074888F0810D0C1A7007223A83A38CE21C0000000000C000 |
---|
2980 | C000040000000000010000000000000000000000000000000000C000 |
---|
2981 | C03FFC00000000000E0000000000000000000000000000000000C000 |
---|
2982 | C000000000000000000000000000000000000000000000000000C000 |
---|
2983 | C000000000000000000000000000000000000000000000000000C000 |
---|
2984 | C000000000000000000000000000000000000000000000000000C000 |
---|
2985 | C000000000000000000000000000000000000000000000000000C000 |
---|
2986 | C000000000000000000000000000000000000000000000000000C000 |
---|
2987 | C000000000000000000000000000000000000000000000000000C000 |
---|
2988 | C000000000000000000000000000000000000000000000000000C000 |
---|
2989 | C000000000000000000000000000000000000000000000000000C000 |
---|
2990 | C000000000000000000000000000000000000000000000000000C000 |
---|
2991 | C000000000000000000000000000000000000000000000000000C000 |
---|
2992 | C000000000000000000000000000000000000000000000000000C000 |
---|
2993 | C000000000000000000000000000000000000000000000000000C000 |
---|
2994 | C000000000000000000000000000000000000000000000000000C000 |
---|
2995 | C000000000000000000000000000000000000000000000000000C000 |
---|
2996 | C000000000000000000000000000000000000000000000000000C000 |
---|
2997 | C000010000000000000000000000000000000000000000000000C000 |
---|
2998 | C000060000000000000000000000000000000000000000000000C000 |
---|
2999 | C0000C0000088000000000000000000000000000000000000000C000 |
---|
3000 | C000180000088000000000020000000000000000000000000000C000 |
---|
3001 | C000300000080000000000020000000000000000000000000000C000 |
---|
3002 | C00C740007088F161661C2C781E3858700000000000000000000C000 |
---|
3003 | C01EE40008889119199223220224464800000000000000000000C000 |
---|
3004 | C03FE40000889111111222220220444800000000000000000000C000 |
---|
3005 | C01FC400078891111113E2220223C44600000000000000000000C000 |
---|
3006 | C00FC40008889311111202220264444100000000000000000000C000 |
---|
3007 | C007840008888D111112222201A4444100000000000000000000C000 |
---|
3008 | C0038400074881111111C2218023A78E00000000000000000000C000 |
---|
3009 | C001040000000100000000000020040000000000000000000000C000 |
---|
3010 | C03FFC0000000E000000000001C0040000000000000000000000C000 |
---|
3011 | C000000000000000000000000000000000000000000000000000C000 |
---|
3012 | C000000000000000000000000000000000000000000000000000C000 |
---|
3013 | C000000000000000000000000000000000000000000000000000C000 |
---|
3014 | C000000000000000000000000000000000000000000000000000C000 |
---|
3015 | C000000000000000000000000000000000000000000000000000C000 |
---|
3016 | C000000000000000000000000000000000000000000000000000C000 |
---|
3017 | C000000000000000000000000000000000000000000000000000C000 |
---|
3018 | C000000000000000000000000000000000000000000000000000C000 |
---|
3019 | C000000000000000000000000000000000000000000000000000C000 |
---|
3020 | C000000000000000000000000000000000000000000000000000C000 |
---|
3021 | C000000000000000000000000000000000000000000000000000C000 |
---|
3022 | C000000000000000000000000000000000000000000000000000C000 |
---|
3023 | C000000000000000000000000000000000000000000000000000C000 |
---|
3024 | C000000000000000000000000000000000000000000000000000C000 |
---|
3025 | C000000000000000000000000000000000000000000000000000C000 |
---|
3026 | C000010000000000000000000000000000000000000000000000C000 |
---|
3027 | C000060000000000000000000000000000000000000000000000C000 |
---|
3028 | C0000C0000000000080008000000000000000000000000000000C000 |
---|
3029 | C000180004000000080108000000000000000000000000000000C000 |
---|
3030 | C000300004000000080100000000000000000000000000000000C000 |
---|
3031 | C00C74000F59C2C388E3C86161C0000000000000000000000000C000 |
---|
3032 | C01EE40004622324091108919200000000000000000000000000C000 |
---|
3033 | C03FE40004402224081109091200000000000000000000000000C000 |
---|
3034 | C01FC4000441E22308F109091180000000000000000000000000C000 |
---|
3035 | C00FC40004422220891109091040000000000000000000000000C000 |
---|
3036 | C007840004422220891108911040000000000000000000000000C000 |
---|
3037 | C00384000341D22708E8C8611380000000000000000000000000C000 |
---|
3038 | C001040000000000000000000000000000000000000000000000C000 |
---|
3039 | C03FFC0000000000000000000000000000000000000000000000C000 |
---|
3040 | C000000000000000000000000000000000000000000000000000C000 |
---|
3041 | C000000000000000000000000000000000000000000000000000C000 |
---|
3042 | C000000000000000000000000000000000000000000000000000C000 |
---|
3043 | C000000000000000000000000000000000000000000000000000C000 |
---|
3044 | C000000000000000000000000000000000000000000000000000C000 |
---|
3045 | C000000000000000000000000000000000000000000000000000C000 |
---|
3046 | C000000000000000000000000000000000000000000000000000C000 |
---|
3047 | C000000000000000000000000000000000000000000000000000C000 |
---|
3048 | C000000000000000000000000000000000000000000000000000C000 |
---|
3049 | C000000000000000000000000000000000000000000000000000C000 |
---|
3050 | C000000000000000000000000000000000000000000000000000C000 |
---|
3051 | C000000000000000000000000000000000000000000000000000C000 |
---|
3052 | C000000000000000000000000000000000000000000000000000C000 |
---|
3053 | C000000000000000000000000000000000000000000000000000C000 |
---|
3054 | C000000000000000000000000000000000000000000000000000C000 |
---|
3055 | C000000000000000000000000000000000000000000000000000C000 |
---|
3056 | C000000000000000000000000000000000000000000000000000C000 |
---|
3057 | C000000000000000000000000000000000000000000000000000C000 |
---|
3058 | C000000000000000000000000000000000000000000000000000C000 |
---|
3059 | C000000000000000000000000000000000000000000000000000C000 |
---|
3060 | C000000000000000000000000000000000000000000000000000C000 |
---|
3061 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000 |
---|
3062 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000 |
---|
3063 | 00000000000000000000000000000000000000000000000000000000 |
---|
3064 | 00000000000000000000000000000000000000000000000000000000 |
---|
3065 | 00000000000000000000000000000000000000000000000000000000 |
---|
3066 | 00000000000000000000000000000000000000000000000000000000 |
---|
3067 | 599 90 gm |
---|
3068 | (nc 31 30 761 582 6 rc)kp |
---|
3069 | 1 setTxMode |
---|
3070 | 12 fz |
---|
3071 | 2 F /|______Times-Roman fnt |
---|
3072 | 1.17477 0. 32 0.11747 0.(Get info...)awidthshow |
---|
3073 | 611 90 gm |
---|
3074 | 10 fz |
---|
3075 | 2 F /|______Times-Roman fnt |
---|
3076 | -0.01683 0.(This option allows the viewing and setting of attributes associated with each individual sequence. These)ashow |
---|
3077 | 622 90 gm |
---|
3078 | -0.00477 0.(attributes include short name, full name, description, author, comments, and the sequence type. The)ashow |
---|
3079 | 633 90 gm |
---|
3080 | -0.03654 0.(attributes loosely correspond to fields in a Genbank entry. Comments can be included for each sequence in)ashow |
---|
3081 | 644 90 gm |
---|
3082 | -0.00778 0.(the comments field.)ashow |
---|
3083 | F T cp |
---|
3084 | %%Page: ? 10 |
---|
3085 | op |
---|
3086 | 31 30 xl |
---|
3087 | 1 1 pen |
---|
3088 | 753 90 gm |
---|
3089 | (nc 31 30 761 582 6 rc)kp |
---|
3090 | 1 setTxMode |
---|
3091 | 0 fs |
---|
3092 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
3093 | 7 fz |
---|
3094 | 2 F /|______Times-Roman fnt |
---|
3095 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
3096 | 753 300 gm |
---|
3097 | 12 fz |
---|
3098 | 2 F /|______Times-Roman fnt |
---|
3099 | (10)show |
---|
3100 | 0 0 gm |
---|
3101 | (nc 72 162 251 419 6 rc)kp |
---|
3102 | 64 gr |
---|
3103 | 73 163 250 418 1 rc |
---|
3104 | T 255 11.87997 163 73 74 579 27 T 1 db |
---|
3105 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
3106 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
3107 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000 |
---|
3108 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000 |
---|
3109 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3110 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3111 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3112 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3113 | C000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3114 | C000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3115 | C000000400000000000000000000000000000000000000000000000000000000000000000000003800000000018000000000000000000000000000000000000000000000000000006000 |
---|
3116 | C0003F8400000000000000000000000000000000000000000000000003C00000000000000018006000000000218000000000000000000000000000000000000000000000000000006000 |
---|
3117 | C000200400000000000000000000000000000000000000000000000006600000000000000018006000000000600000000000000000000000000000000000000000000000000000006000 |
---|
3118 | C00010040000000000000000000000000000000000000000000000000603C3E331E1B0F1E018D8F9E366CC3CF98F0D800000000000000000000000000000000000000000000000006000 |
---|
3119 | C0001004000000000000000000000000000000000000000000000000070666633331D99B3018EC633367766661998EC00000000000000000000000000000000000000000000000006000 |
---|
3120 | C000080400000000000000000000000000000000000000000000000003C66663333199833018CC633386660661998CC00000000000000000000000000000000000000000000000006000 |
---|
3121 | C000080400000000000000000000000000000000000000000000000000E7E66333F19983F018CC633306663E61998CC00000000000000000000000000000000000000000000000006000 |
---|
3122 | C000000400000000000000000000000000000000000000000000000000660663330199830018CC633306666661998CC00000000000000000000000000000000000000000000000006000 |
---|
3123 | C0000004000000000000000000000000000000000000000000000000066626E37311998B1018CC633306666661998CC00000000000000000000000000000000000000000000000006000 |
---|
3124 | C000000400000000000000000000000000000000000000000000000003C3C361B1E198F1E018CC61E306663B398F0CC00000000000000000000000000000000000000000000000006000 |
---|
3125 | C000000400000000000000000000000000000000000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3126 | C001FFF800000000000000000000000000000000000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3127 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3128 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3129 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3130 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3131 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3132 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3133 | C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC6000 |
---|
3134 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3135 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3136 | T 255 11 163 84.87997 74 579 25 T 1 db |
---|
3137 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3138 | C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC6000 |
---|
3139 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3140 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3141 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3142 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3143 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3144 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3145 | C000000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3146 | C000078210200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3147 | C000084220200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3148 | C000102240100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3149 | C000102280100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3150 | C000102380100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3151 | C000102240100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3152 | C000102220100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3153 | C000084210100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3154 | C000078210100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3155 | C000000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3156 | C000000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3157 | C000000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3158 | C008000000800000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3159 | C006000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3160 | C001FFFFFC000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3161 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3162 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3163 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3164 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3165 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3166 | T 255 11 163 95.87997 74 579 25 T 1 db |
---|
3167 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3168 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3169 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3170 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3171 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3172 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3173 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3174 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3175 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3176 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3177 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3178 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001FFFFFFFFFF80000000000080000000000020000000000000000080006000 |
---|
3179 | C000180000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3180 | C01E18000020000000000000208823C3C7C10861E00000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3181 | C033180000600000000000003188242224218861100000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3182 | C0301B0F1BF81B0F0D9878003184480224118891100000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3183 | C0381D999B601D998EECCC002A84480224114891100000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3184 | C01E19999C6019818CCCCC002A828803C4116891E00000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3185 | C00719999860198F8CCCFC0024810802441129F9100000000000000000000000003FC00000000000F084300180F8210C00003FBE427F00802083078840200F0F0787F7C4420080006000 |
---|
3186 | C0031999986019998CCCC0002481080224111909100000000000000000000000000600000000000088C430018084310C0000042042080080318308088020088888408404620080006000 |
---|
3187 | C0331999986019998CCCC4002081042224211909140000000000000000000000000618CD878C000088C44801808231120000042024080080318488090020088890208404620080006000 |
---|
3188 | C01E198F1838198ECCCC7800208103C227C10909EA0000000000000000000000000618CECCCC000088A448018082291200000420140800802A848C0A0020088890208404520080006000 |
---|
3189 | C0000000000000000000000000000000000000001500000000000000000000000006188CCCC00000F0B4480180822D120000043C180800802A84870E0020088F102087845A0080006000 |
---|
3190 | C0000000000000000000000000000000000000002A800000000000000000000000060D8CCFC000009094FC018082253F0000042028080080248FC18900200F09102084044A0080006000 |
---|
3191 | C00000000000000000000000000000000000000015000000000000000000000100060D0CCC000000888C8401808223210000042024080080248840888020080890208404460080006000 |
---|
3192 | C000000000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0006070CCC4C0000888C8401808423210000042042080080208840884020080888408404460080006000 |
---|
3193 | C0000000000000000000000000000000000000000400000000000000000000000006060F878C00008884840180F821210000043E4208008020884F0840200808878087C4420080006000 |
---|
3194 | C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3195 | C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3196 | T 255 11 163 106.87997 74 579 25 T 1 db |
---|
3197 | C000000000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0006070CCC4C0000888C8401808423210000042042080080208840884020080888408404460080006000 |
---|
3198 | C0000000000000000000000000000000000000000400000000000000000000000006060F878C00008884840180F821210000043E4208008020884F0840200808878087C4420080006000 |
---|
3199 | C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3200 | C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3201 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3202 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3203 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3204 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000 |
---|
3205 | C00000000000000000000000000000000000000000000000000000000000000000000000000000FFFFFFFFFF80000000001FFFFFFFFFFFBFFFFFFFFFFFEFFFFFFFFFFFFFFFFF80006000 |
---|
3206 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3207 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3208 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3209 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3210 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3211 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3212 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3213 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3214 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3215 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3216 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3217 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3218 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3219 | C0000018C0000000000000000000000010000000001000000202002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3220 | C01F8018C0000000000000082000000010000000001000000202002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3221 | C0180018C00000000000000C6000000010000000001000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3222 | C0183318C06C3C3661E0000C6221C61611C38B30E0162218B2C22C2380000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3223 | C0183318C076663BB330000AA222091912240CC910192224C322322400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3224 | C01F3318C06606333330000AA224109110240888101122428222222400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3225 | C0183318C0663E3333F000092144109111E30888F01114428222222300000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3226 | T 255 11 163 117.87997 74 579 25 T 1 db |
---|
3227 | C0183318C06C3C3661E0000C6221C61611C38B30E0162218B2C22C2380000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3228 | C0183318C076663BB330000AA222091912240CC910192224C322322400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3229 | C01F3318C06606333330000AA224109110240888101122428222222400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3230 | C0183318C0663E3333F000092144109111E30888F01114428222222300000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3231 | C0183318C0666633330000092144109112208889101114428222222080000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3232 | C0183718C0666633331000082082091112208889101108248222222080000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3233 | C0181B18C0663B3331E000082081C61E11D70888E81108188222222700000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3234 | C000000000000000000000000100001000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3235 | C000000000000000000000000300001000000000000030000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3236 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000004000000000000000000000000000000000000000006000 |
---|
3237 | C0000000000000000000001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000000000000000000000000000000000000000006000 |
---|
3238 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3239 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3240 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3241 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3242 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3243 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3244 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3245 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3246 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3247 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3248 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3249 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3250 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3251 | C000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3252 | C018F80388000003000000000020878FC7830180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3253 | C018CC0388000003000000000031884808448280000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3254 | C018C602C8CC6CC361E360000031804800484480000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3255 | C018C602C8CC7763B3336000002A804F80484880000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3256 | T 255 11 163 128.87997 74 579 25 T 1 db |
---|
3257 | C018F80388000003000000000020878FC7830180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3258 | C018CC0388000003000000000031884808448280000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3259 | C018C602C8CC6CC361E360000031804800484480000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3260 | C018C602C8CC7763B3336000002A804F80484880000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3261 | C018C602E8CC666333338000002A838043885080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3262 | C018C60268CC666333F300000024804040485FC0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3263 | C018C60238CC6663330300000024804040484080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3264 | C018CC0238DC6663331300000020884848448080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3265 | C018F802186C6663E1E300000020878787830080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3266 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3267 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3268 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000006000 |
---|
3269 | C00000000000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF000000000000000000000000000000000000006000 |
---|
3270 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3271 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3272 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3273 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3274 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3275 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3276 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3277 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3278 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3279 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3280 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3281 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3282 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3283 | C000000000003000060000000000200000040400400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3284 | C01F0000000030008600000008202000000404004000C00000000000400000000000000007C1086000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3285 | C019800000000001800000000C602000000400000000C0000000000040000000000000000421886000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3286 | T 255 11 163 139.87997 74 579 25 T 1 db |
---|
3287 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3288 | C000000000003000060000000000200000040400400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3289 | C01F0000000030008600000008202000000404004000C00000000000400000000000000007C1086000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3290 | C019800000000001800000000C602000000400000000C0000000000040000000000000000421886000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3291 | C018C787C79B31B3E63C36000C602C443165845847012002CE161C38F038E1E22385839C0411889000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3292 | C018CCCC0CDB31D986663B000AA0324449864464480120031119224440411222244644220411489000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3293 | C018CCCE0C1C3199866633000AA0224485044444480123FA1111220440411222244448220411689000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3294 | C018CFC78C1831998666330009202228850444444603F0021F113E3C4031F22227C4483E041129F800000000000000000000000000000000000000000000000000000000000000006000 |
---|
3295 | C018CC01CC183199866633000920222885044444410210021011204440090222240448200411190800000000000000000000000000000000000000000000000000000000000000006000 |
---|
3296 | C0198C40CC583199866633000822221049044444410210021111224440091262644444220421190900000000000000000000000000000000000000000000000000000000000000006000 |
---|
3297 | C01F078F879831F0E63C330008222210310444444E0210020E1E1C3A3070E1A1A384439C07C1090900000000000000000000000000000000000000000000000000000000000000006000 |
---|
3298 | C000000000000180000000000000002000000000000000000010000000000020000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3299 | C000000000000180000000000000006000000000000000000010000000000020000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3300 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000000000000000000000000006000 |
---|
3301 | C000000000000000000000001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC0000000000000000000000000000000000000006000 |
---|
3302 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3303 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3304 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3305 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3306 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3307 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3308 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3309 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3310 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3311 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3312 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3313 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3314 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3315 | C000000030000000000000000080000000000000000000220000000000040000000000000004000000000000080000000000000000000000000000000000000000000000000000006000 |
---|
3316 | T 255 11 163 150.84613 74 579 26 T 1 db |
---|
3317 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3318 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3319 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3320 | C000000030000000000000000080000000000000000000220000000000040000000000000004000000000000080000000000000000000000000000000000000000000000000000006000 |
---|
3321 | C00600043000000000007F00008000104030001E000000220781080040440000420F00000004041002002000080104030000000000000000000000000000000000000000000000006000 |
---|
3322 | C006000C300000000000080000800018C030001000000022044108004040000044100000000406300200200008018C030000000000000000000000000000000000000000000000006000 |
---|
3323 | C00B0CDF361E36000000083888862C18C048001038B59C2204410800444471C048100038583C0630722C78C38B018C048000000000000000000000000000000000000000000000006000 |
---|
3324 | C00B0CCC3B33360000000844888930154048001044C6222204410800444482205018004464440550823221240C8154048000000000000000000000000000000000000000000000006000 |
---|
3325 | C0130CCC33333800000008048890A0154048001E44842222078090002A848220700E00044444055102222214088154048000000000000000000000000000000000000000000000006000 |
---|
3326 | C01F8CCC333330000000083C5090A01240FC00107C843E22048090002A8463E04803003C44440491022222130881240FC000000000000000000000000000000000000000000000006000 |
---|
3327 | C0318CCC33333000000008445090A0124084001040842022044090002A841200440100444444049102222210888124084000000000000000000000000000000000000000000000006000 |
---|
3328 | C0318DCC3333300000000844208921104484901044842222444861201104122442812044444C041082222120889104484800000000000000000000000000000000000000000000006000 |
---|
3329 | C03186C7331E30000000083A208621104484901038841C22444861201104E1C4429E203A44340410722218C7089104484800000000000000000000000000000000000000000000006000 |
---|
3330 | C000000000000000000000004000020000002000000000008000004000000008000000000000000000000000002000000000000000000000000000000000000000000000000000006000 |
---|
3331 | C00000000000000000000000C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3332 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000006000 |
---|
3333 | C00000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF000000000000000000000000000000000000000000006000 |
---|
3334 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3335 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3336 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3337 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3338 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3339 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3340 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3341 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3342 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3343 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3344 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3345 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3346 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3347 | T 255 11 163 161.87997 74 579 25 T 1 db |
---|
3348 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3349 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3350 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3351 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3352 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3353 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3354 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3355 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3356 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3357 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3358 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3359 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3360 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3361 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3362 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3363 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3364 | C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000206000 |
---|
3365 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3366 | C40000000000000000000000000000000000000000000000000000000000000008000000804001000000000000000E000000000000000000000000000000000000000000002000206000 |
---|
3367 | C4010BE448463C707800000006000000000004001E1889E0E7C00000000002100800000080400100003844300000020000000000E1070E00380000000000000000000000002000206000 |
---|
3368 | C401120448492248800000000600000000000400202489112400000000000330080000008000000000246430000002000000000123089100440000000000000000000000002000206000 |
---|
3369 | C40122044B50A2448000000009002C7161C38F802042891204000000000003300B111C2CB1C2C707802264480001C20E2C380162050881000400000000000000000000000023FFE06000 |
---|
3370 | C40142028B50A244C000000009003089922444003042891204000000000002D00C912230C843210800225448000202113244019201088100040000000000000000000000002000006000 |
---|
3371 | C401C3C28B50BC4470000000093E2089122044001C4289E207800000000002D0089122208842210800225448000402112244011201088200180000000000000000000000002000006000 |
---|
3372 | C40122010490A444180000001F8020F913E3C4000642892204000000000002D0088A22208842210700224CFC00040211227C011221088400040000000000000000000000002000006000 |
---|
3373 | C40112010490A244080000001080208112044400024289120400000000000210088A22208842210080224C84000402112240011221088800040000000000000000000000002000206000 |
---|
3374 | C4010A010489224808000000108020891224440C022489110400000000000213088422208842210080244484600202112244011121089018446000000000000000000000002000206000 |
---|
3375 | C4010BE104862270F000000010802071E1C3A38C3C187110E7C000000000021308841C208842210F003844846001C20E223801E0E1071F18386000000000000000000000002000206000 |
---|
3376 | C400000000000000000000000000000100000000000000000000000000000000000800000000000000000000C00000000000010000000000000000000000000000000000002000206000 |
---|
3377 | T 255 11 163 172.87997 74 579 25 T 1 db |
---|
3378 | C40112010490A244080000001080208112044400024289120400000000000210088A22208842210080224C84000402112240011221088800040000000000000000000000002000206000 |
---|
3379 | C4010A010489224808000000108020891224440C022489110400000000000213088422208842210080244484600202112244011121089018446000000000000000000000002000206000 |
---|
3380 | C4010BE104862270F000000010802071E1C3A38C3C187110E7C000000000021308841C208842210F003844846001C20E223801E0E1071F18386000000000000000000000002000206000 |
---|
3381 | C400000000000000000000000000000100000000000000000000000000000000000800000000000000000000C00000000000010000000000000000000000000000000000002000206000 |
---|
3382 | C400000000000000000000000000000100000000000000000000000000000000001800000000000000000000000000000000010000000000000000000000000000000000002018206000 |
---|
3383 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000203C206000 |
---|
3384 | C4000000000000000000000000000080000000000000000000000000100000000000000020000000000000000387020000000000000000000001C000000000000000000000207E206000 |
---|
3385 | C400000000000000000000001E00008000000008000001E0000400001000000FE000000020000200000000840081020000200000000840000000400000000000000000000020FF206000 |
---|
3386 | C4000000000000000000000011000080000000080000011000040000000000010000000000000200000000CC0081000000200000000CC0000000400000000000000000000020FF206000 |
---|
3387 | C4000000000000000000000011163888E164471F1C300111C1CF8E167070C00107161C2CE07227C70F1800CCE0810E07227C70F1800CD10E38B041C3CA8E1E3000000000002000206000 |
---|
3388 | C40000000000000000000000111844911184488822300112220411181088C0010899223020822208901800B51081020822208901800B511044C842240F91203000000000002000206000 |
---|
3389 | C40000000000000000000000111044A011044888020001E024041110100800010891222021022208900000B51081021022208900000B5120448840240A81200000000000002000206000 |
---|
3390 | C400000000000000000000001E1044E0F10288881E000111E4041F10107800010F913E202102220F8E0000B5108102102220F8E0000B4A20448841E38A8F1C0000000000002000206000 |
---|
3391 | C400000000000000000000001010449111028888220001122404101010880001081120202102220801000085108102102220801000084A20448842204A91020000000000002000206000 |
---|
3392 | C40000000000000000000000101044891101088822300112220411101088C001089122202082620881180085108102082620881180084410448842204A91023000000000002000206000 |
---|
3393 | C4000000000000000000000010103884E90107071D3001E1D1C38E101074C00107111C202071A1C71E180084E08102071A1C71E18008440E38F041D78A8EBC3000000000002000206000 |
---|
3394 | C400000000000000000000000000000000020000006000000000000000018000000000000000000000300000000000000000000300000800008000000000006000000000002000206000 |
---|
3395 | C400000000000000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000001800008000000000000000000000002000206000 |
---|
3396 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3397 | C400000000000000000000000000000003800000000001C00000000000000007000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3398 | C400000000000000000000001080000000800000002000400000002100000001000000004000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3399 | C400000000000000000000001980000000800000002000400000003300000001000000004000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3400 | C4000000000000000000000019A21C71608387951C7C7041C3C600334438E2C1070F2A38F8E0E3870E000000000000000000000000000000000000000000000000000000002000206000 |
---|
3401 | C4000000000000000000000016A220899084481F222088422406002D4441132108903E444111044891000000000000000000000000000000000000000000000000000000002000206000 |
---|
3402 | C4000000000000000000000016A2408910804815022008422400002D4481122100902A044012044091000000000000000000000000000000000000000000000000000000002000206000 |
---|
3403 | C40000000000000000000000169440891083C7151E207843E380002D28811221078E2A3C40F207C79F000000000000000000000000000000000000000000000000000000002000206000 |
---|
3404 | C40000000000000000000000109440891084409522208842004000212881122108812A444112040890000000000000000000000000000000000000000000000000000000002000206000 |
---|
3405 | C40000000000000000000000108820891084409522208842204600211041122108812A444111044891180000000000000000000000000000000000000000000000000000002000206000 |
---|
3406 | C4000000000000000000000010881C71E083AF151D1C7441C78600211038E3C1075E2A3A38E8E3874E180000000000000000000000000000000000000000000000000000002000206000 |
---|
3407 | T 255 11 163 183.87997 74 579 25 T 1 db |
---|
3408 | C40000000000000000000000169440891083C7151E207843E380002D28811221078E2A3C40F207C79F000000000000000000000000000000000000000000000000000000002000206000 |
---|
3409 | C40000000000000000000000109440891084409522208842004000212881122108812A444112040890000000000000000000000000000000000000000000000000000000002000206000 |
---|
3410 | C40000000000000000000000108820891084409522208842204600211041122108812A444111044891180000000000000000000000000000000000000000000000000000002000206000 |
---|
3411 | C4000000000000000000000010881C71E083AF151D1C7441C78600211038E3C1075E2A3A38E8E3874E180000000000000000000000000000000000000000000000000000002000206000 |
---|
3412 | C40000000000000000000000001000010000000000000000000C0000200002000000000000000000000000000000000000000000000000000000000000000000000000000023FFE06000 |
---|
3413 | C400000000000000000000000030000100000000000000000000000060000200000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3414 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3415 | C400000000000000000000000000001900000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3416 | C401E3E3CF9E3E4439F0000004000021000000000010008000020E1C10000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3417 | C401120208112064490000000C00002100000000003000800006112210000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3418 | C401120208112064810000001400004161C3C70F005001F1C00A1122080000000000000000000000000000000000000000000000000000000000000000000000000000000020FF206000 |
---|
3419 | C4011202081120548100000004000041922408900010008220021122080000000000000000000000000000000000000000000000000000000000000000000000000000000020FF206000 |
---|
3420 | C401E3C3CF1E3C5481E0000004000041102408900010008220020F220800000000000000000000000000000000000000000000000000000000000000000000000000000000207E206000 |
---|
3421 | C40122020812204C810000000400004111E38F8E00100082200201220800000000000000000000000000000000000000000000000000000000000000000000000000000000203C206000 |
---|
3422 | C40112020811204C810000000400004112204801001000822002012208000000000000000000000000000000000000000000000000000000000000000000000000000000002018206000 |
---|
3423 | C401120208112044410000000400002112204881001000822002112210000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3424 | C40113E20F913E4439F0000004000021E1D7871E00100071C0020E1C10000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3425 | C400000000000000000000000000001800000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3426 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3427 | C4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000023FFE06000 |
---|
3428 | C400000000000000000000000000100000000000020000000000000000000000000002003840010000000000000002000004200000000400000000800804000001000000002000006000 |
---|
3429 | C400000FEFBF907C000000001E001040000004000200E110C00000000000000000000200404001000000000000000200000420000000041000000082080400004100000000201C006000 |
---|
3430 | C40000010204104000000000110000400000040002009190C00000000000000000000200400000000000000000000000000400000000001000000002080000004100000000201C006000 |
---|
3431 | C40000010204104000000000111C70F8E1638F8E1E00899120078E1E447160E387801E38F9C2C70B0F003C7161C54E07003CE111C2C79C3E44011387CB1C2C00F961C00000201C006000 |
---|
3432 | C400000102041040000000001122104111844411220089512008112244899104480022444043210C910044899227C2080044211223080410440150820C8432004192200000201C006000 |
---|
3433 | C400000102041078000000001E2210411100441122008951200811224489120448002244404221089100448912254210004421122208041044015082088422004112200000201C006000 |
---|
3434 | C40000010204104000000000123E1041F103C41F22008933F0071F2244F91207C700227C40422108910044F912254210004420A3E207041028015082088422004113E00000201C006000 |
---|
3435 | C400000102041040000000001120104101044410220089321000902244811204008022404042210893004C8112254210004420A2020084102800A082088422004112000000201C006000 |
---|
3436 | C40000010204104000000000112210411104441126009112100091264C89110440802644404221088D00348912254208004C2042220084101000A082088422004112200000201C006000 |
---|
3437 | T 255 11 163 194.87997 74 579 25 T 1 db |
---|
3438 | C400000102041078000000001E2210411100441122008951200811224489120448002244404221089100448912254210004421122208041044015082088422004112200000201C006000 |
---|
3439 | C40000010204104000000000123E1041F103C41F22008933F0071F2244F91207C700227C40422108910044F912254210004420A3E207041028015082088422004113E00000201C006000 |
---|
3440 | C400000102041040000000001120104101044410220089321000902244811204008022404042210893004C8112254210004420A2020084102800A082088422004112000000201C006000 |
---|
3441 | C40000010204104000000000112210411104441126009112100091264C89110440802644404221088D00348912254208004C2042220084101000A082088422004112200000201C006000 |
---|
3442 | C40000010F841E7C00000000111C1038E103A38E1A00E112100F0E1A347110E38F001A38404221088100047111C5420700342041C20F040E1000A081C88422003911C00000201C006000 |
---|
3443 | C40000000000000000000000000000000000000000000000000000020000000000000000000000000100040000000000000000000000000020000000000000000000000000201C006000 |
---|
3444 | C40000000000000000000000000000000000000000000000000000020000000000000000000000000E00380000000000000000000000000060000000000000000000000000201C006000 |
---|
3445 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3446 | C40000000000000000000000000000004000000000000003800000000080000008040010000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3447 | C40000000000000000000000000000004000001080000000800000000080000008040010000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3448 | C40000000000000000000000000000000000001980000000800000000080000008000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3449 | C400000000000000000000000F2C3839C1C3C019A21C71608387951C00B111C2CB1C2C70780000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3450 | C400000000000000000000001032444042240016A220899084481F2200C912230C843210800000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3451 | C400000000000000000000001022448042240016A2408910804815020089122208842210800000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3452 | C400000000000000000000000E227C8043E380169440891083C7151E0088A22208842210700000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3453 | C40000000000000000000000012240804200401094408910844095220088A22208842210080000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3454 | C40000000000000000000000012244404220401088208910844095220088422208842210080000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3455 | C400000000000000000000001E3C383841C78010881C71E083AF151D008841C208842210F00000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3456 | C40000000000000000000000002000000000000010000100000000000000800000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3457 | C40000000000000000000000002000000000000030000100000000000001800000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3458 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3459 | C40000000000000000000000000070000001000000402003800000000000000000000000180000001800000000000000000000000000000000000000000000000000000000201C006000 |
---|
3460 | C4000007C3113C443080000010801000021100000040200080000E000070E3E0071F1C002041C3870400000000000000000000000000000000000000000000000000000000201C006000 |
---|
3461 | C4000001049122643080000019801000033000000040000080001100008912000881220020C224488400000000000000000000000000000000000000000000000000000000201C006000 |
---|
3462 | C40000010851226448800000199C10000337038B1C58E0E0800001000081020008010200414224488200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3463 | C4000001085122544880000016A2100002D1040C2264211080000100008103C008020200404224488200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3464 | C400000108513C544880000016A2100002D10808224421108000020000F1E027CF0404004041E3870200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3465 | C40000010851244CFC80000016A2100002D1080822442110800004000089102008840800404024488200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3466 | C40000010851224C8480000010A210000211080822442110800008000089102008881000404024488200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3467 | T 255 11 163 205.87997 74 579 25 T 1 db |
---|
3468 | C4000001085122544880000016A2100002D1040C2264211080000100008103C008020200404224488200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3469 | C400000108513C544880000016A2100002D10808224421108000020000F1E027CF0404004041E3870200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3470 | C40000010851244CFC80000016A2100002D1080822442110800004000089102008840800404024488200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3471 | C40000010851224C8480000010A210000211080822442110800008000089102008881000404024488200000000000000000000000000000000000000000000000000000000201C006000 |
---|
3472 | C4000001049122448480000010A2106002110408224421108300100C0089122008882000204224488400000000000000000000000000000000000000000000000000000000201C006000 |
---|
3473 | C400000E030E224484F00000109C1060021103881C7820E083001F0C0070E1C007083E002041C3870400000000000000000000000000000000000000000000000000000000201C006000 |
---|
3474 | C40000000000000000000000000000000000000000000000000000180000000000000000180000001800000000000000000000000000000000000000000000000000000000201C006000 |
---|
3475 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3476 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3477 | C4000000000000000000000000080001C0000000001C3800000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3478 | C4000003DFC6227031E38000000800004000000800204000000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3479 | C40000040206324831124000000000004000000800204000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3480 | C400000402093244491220000F3854B041C0079F1C7CF80163889C1C4400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3481 | C400000602092A444912200010087CC84220080822204001844884225400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3482 | C400000382092A4449E22000100854884220080802204001044884225400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3483 | C4000000C21FA644FD2220000E08548843E007081E20400107C5043E5400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3484 | C40000004210A64485122000010854884200008822204001040504202800000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3485 | C40000004210A24885124000010854884220008822204001044204222800000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3486 | C40000078210A270851380001E0854F041C00F071D2040010382041C2800000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3487 | C400000000000000000000000000008000000000000003F8000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3488 | C40000000000000000000000000000800000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3489 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3490 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3491 | C401E0C3CF800E188917F0000000000001C7C000000000000107000000000000070E000000000000021C004000000000000000000000000000000000000000000000000000201C006000 |
---|
3492 | C40110C40800122489908000000000000220400000000000030880000000000008910000000000000622004000000000000000000000000000000000000000000000000000201C006000 |
---|
3493 | C40111240800204289908000000000000220400E000000000508000E000000000091003C000000000A2200F800000000000000000000000000000000000000000000000000201C006000 |
---|
3494 | C40111260800204289508000000000000220801100000000010800100000000000910044000000001222004000000000000000000000000000000000000000000000000000201C006000 |
---|
3495 | C401E1238F002042895080000000000001C1000100000000010F002000000000030E004400000000221E004000000000000000000000000000000000000000000000000000201C006000 |
---|
3496 | C40113F0C800204289308000000000000221000F00000000010880200000000000910044000000003F02004000000000000000000000000000000000000000000000000000201C006000 |
---|
3497 | T 255 11 163 216.87997 74 579 25 T 1 db |
---|
3498 | C40111240800204289908000000000000220400E000000000508000E000000000091003C000000000A2200F800000000000000000000000000000000000000000000000000201C006000 |
---|
3499 | C40111260800204289508000000000000220801100000000010800100000000000910044000000001222004000000000000000000000000000000000000000000000000000201C006000 |
---|
3500 | C401E1238F002042895080000000000001C1000100000000010F002000000000030E004400000000221E004000000000000000000000000000000000000000000000000000201C006000 |
---|
3501 | C40113F0C800204289308000000000000221000F00000000010880200000000000910044000000003F02004000000000000000000000000000000000000000000000000000201C006000 |
---|
3502 | C4011210480020428930800000000000022200110000000001088020000000000091004C000000000202004000000000000000000000000000000000000000000000000000201C006000 |
---|
3503 | C40112104800102489108000000000000222001100000000010880100000000008910034000000000222004000000000000000000000000000000000000000000000000000201C006000 |
---|
3504 | C401E2178F800E18711080000000000001C2000E800000000107000E00000000070E000400000000021C003800000000000000000000000000000000000000000000000000201C006000 |
---|
3505 | C40000000000000000000000000000000000000000000000000000000000000000000004000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3506 | C40000000000000000000000000000000000000000000000000000000000000000000038000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3507 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3508 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3509 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3510 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3511 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3512 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3513 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3514 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3515 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3516 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3517 | C40400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3518 | C40A00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3519 | C41500000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3520 | C42A80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3521 | C41500000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3522 | C40A00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3523 | C40400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3524 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3525 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3526 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3527 | T 255 11 163 227.87997 74 579 25 T 1 db |
---|
3528 | C40400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3529 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3530 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3531 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3532 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3533 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3534 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3535 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3536 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3537 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3538 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3539 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3540 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3541 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3542 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3543 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3544 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3545 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3546 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3547 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3548 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3549 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3550 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3551 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3552 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3553 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3554 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3555 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3556 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3557 | T 255 12 163 238.92306 74 579 26 T 1 db |
---|
3558 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3559 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3560 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3561 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3562 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3563 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3564 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3565 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3566 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3567 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3568 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3569 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3570 | C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000 |
---|
3571 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000006000 |
---|
3572 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000006000 |
---|
3573 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3574 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3575 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3576 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3577 | C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000 |
---|
3578 | C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE3FFE06000 |
---|
3579 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3580 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3581 | C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000 |
---|
3582 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000 |
---|
3583 | FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000 |
---|
3584 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
3585 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
3586 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
3587 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
3588 | 285 90 gm |
---|
3589 | (nc 31 30 761 582 6 rc)kp |
---|
3590 | 1 setTxMode |
---|
3591 | 14 fz |
---|
3592 | 2 F /|______Times-Roman fnt |
---|
3593 | 0.53985 0. 32 0.05398 0.( Edit menu)awidthshow |
---|
3594 | 308 90 gm |
---|
3595 | 12 fz |
---|
3596 | 2 F /|______Times-Roman fnt |
---|
3597 | -0.29429 0.(Select All)ashow |
---|
3598 | 320 90 gm |
---|
3599 | 10 fz |
---|
3600 | 2 F /|______Times-Roman fnt |
---|
3601 | -0.03724 0.(Selects all sequences. This is helpful when you have several dozen sequences.)ashow |
---|
3602 | 342 90 gm |
---|
3603 | 12 fz |
---|
3604 | 2 F /|______Times-Roman fnt |
---|
3605 | 0.19332 0. 32 0.01933 0.(Select by name...)awidthshow |
---|
3606 | 354 90 gm |
---|
3607 | 10 fz |
---|
3608 | 2 F /|______Times-Roman fnt |
---|
3609 | -0.02021 0.(Select all sequences containing a given string in their short names field. No wild cards are allowed, and only)ashow |
---|
3610 | 365 90 gm |
---|
3611 | -0.01213 0.(selecting is allowed, not de-selecting. The search is started when the Return key is pressed, and multiple)ashow |
---|
3612 | 376 90 gm |
---|
3613 | -0.06175 0.(searches can be accumulated. Press Done when finished.)ashow |
---|
3614 | 398 90 gm |
---|
3615 | 12 fz |
---|
3616 | 2 F /|______Times-Roman fnt |
---|
3617 | -0.08575 0.(Cut/Copy/Paste sequences)ashow |
---|
3618 | 410 90 gm |
---|
3619 | 10 fz |
---|
3620 | 2 F /|______Times-Roman fnt |
---|
3621 | -0.05426 0.(Cut copy and paste are primarily useful for reordering sequences, and for making duplicate copies of a given)ashow |
---|
3622 | 421 90 gm |
---|
3623 | 0.07507 0. 32 0.00750 0.(sequence. They do not pass information to other programs. This capability will be implemented in a later)awidthshow |
---|
3624 | 432 90 gm |
---|
3625 | -0.04278 0.(release. Cut and copy will place the selected sequences on an internal clipboard. They can then be pasted)ashow |
---|
3626 | 443 90 gm |
---|
3627 | -0.06423 0.(back into the top of editing window \(default\) or under the last selected sequence.)ashow |
---|
3628 | 465 90 gm |
---|
3629 | 12 fz |
---|
3630 | 2 F /|______Times-Roman fnt |
---|
3631 | 0.02943 0.(Group/Ungroup)ashow |
---|
3632 | 477 90 gm |
---|
3633 | 10 fz |
---|
3634 | 2 F /|______Times-Roman fnt |
---|
3635 | -0.00544 0.(Assign a group number to the selected sequences. Edit operations in any one sequence within the group will)ashow |
---|
3636 | 488 90 gm |
---|
3637 | 0.00320 0. 32 0.00032 0.(be propagated to all within the group. Sequence protections from one group are also imposed upon all other)awidthshow |
---|
3638 | 499 90 gm |
---|
3639 | 0.07339 0. 32 0.00733 0.(sequence in the given group. If a given operation is illegal in one sequence in a group \(i.e. alignment)awidthshow |
---|
3640 | 510 90 gm |
---|
3641 | 0.06820 0. 32 0.00682 0.(modification\) then it will not work in any of the sequences in that group. Ungroup will remove the selected)awidthshow |
---|
3642 | 521 90 gm |
---|
3643 | -0.05171 0.(sequences from a given group.)ashow |
---|
3644 | 543 90 gm |
---|
3645 | 12 fz |
---|
3646 | 2 F /|______Times-Roman fnt |
---|
3647 | (Compress)show |
---|
3648 | 555 90 gm |
---|
3649 | 10 fz |
---|
3650 | 2 F /|______Times-Roman fnt |
---|
3651 | -0.01747 0.(Compress will remove gap characters from the selected sequences. The user has the option of removing all)ashow |
---|
3652 | 566 90 gm |
---|
3653 | 0.34576 0. 32 0.03457 0.(gaps, or simply all columns containing nothing but gaps. This is useful for minimizing the length of a)awidthshow |
---|
3654 | 577 90 gm |
---|
3655 | 0.05169 0.(subalignment.)ashow |
---|
3656 | 599 90 gm |
---|
3657 | 12 fz |
---|
3658 | 2 F /|______Times-Roman fnt |
---|
3659 | -0.10784 0.(Reverse Sequence)ashow |
---|
3660 | 611 90 gm |
---|
3661 | 10 fz |
---|
3662 | 2 F /|______Times-Roman fnt |
---|
3663 | -0.06991 0.(Reverses the selected sequences. Alignment gaps are reversed as well. The selected sequences will remain)ashow |
---|
3664 | 622 90 gm |
---|
3665 | -0.13101 0.(aligned after reversal.)ashow |
---|
3666 | 647 90 gm |
---|
3667 | 14 fz |
---|
3668 | 2 F /|______Times-Roman fnt |
---|
3669 | 0.04180 0. 32 0.00418 0.( DNA/RNA menu)awidthshow |
---|
3670 | 671 90 gm |
---|
3671 | 12 fz |
---|
3672 | 2 F /|______Times-Roman fnt |
---|
3673 | -0.16490 0.(Complement Sequence)ashow |
---|
3674 | 683 90 gm |
---|
3675 | 10 fz |
---|
3676 | 2 F /|______Times-Roman fnt |
---|
3677 | 0.20431 0. 32 0.02043 0.(Converts DNA/RNA into its complement strand \(keeping full IUPAC ambiguity\). This function has no)awidthshow |
---|
3678 | 694 90 gm |
---|
3679 | -0.01968 0.(effect on text, protein, or mask sequence. Note that this function does not produce the reverse strand of DNA)ashow |
---|
3680 | 705 90 gm |
---|
3681 | -0.02952 0.(but merely converts A<->T and G<->C. If the reverse strand is needed, remember to Complement and)ashow |
---|
3682 | 716 90 gm |
---|
3683 | -0.09683 0.(Reverse the sequence \(Edit menu\).)ashow |
---|
3684 | F T cp |
---|
3685 | %%Page: ? 11 |
---|
3686 | op |
---|
3687 | 31 30 xl |
---|
3688 | 1 1 pen |
---|
3689 | 753 90 gm |
---|
3690 | (nc 31 30 761 582 6 rc)kp |
---|
3691 | 1 setTxMode |
---|
3692 | 0 fs |
---|
3693 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
3694 | 7 fz |
---|
3695 | 2 F /|______Times-Roman fnt |
---|
3696 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
3697 | 753 300 gm |
---|
3698 | 12 fz |
---|
3699 | 2 F /|______Times-Roman fnt |
---|
3700 | (11)show |
---|
3701 | 107 90 gm |
---|
3702 | 14 fz |
---|
3703 | 2 F /|______Times-Roman fnt |
---|
3704 | 0.68984 0. 32 0.06898 0.(External Functions)awidthshow |
---|
3705 | 130 90 gm |
---|
3706 | 10 fz |
---|
3707 | 2 F /|______Times-Roman fnt |
---|
3708 | -0.02468 0.(See appendix C for a full description of functions supported in GDE 2.2 All external functions are described)ashow |
---|
3709 | 141 90 gm |
---|
3710 | 0.00610 0. 32 0.00061 0.(in the configuration file .GDEmenus. Here is a brief description of some of the basic functions included.)awidthshow |
---|
3711 | 163 90 gm |
---|
3712 | 12 fz |
---|
3713 | 2 F /|______Times-Roman fnt |
---|
3714 | -0.16563 0.(File menu)ashow |
---|
3715 | 186 90 gm |
---|
3716 | 10 fz |
---|
3717 | 2 F /|______Times-Roman fnt |
---|
3718 | -0.07015 0.(New Sequence <meta n>)ashow |
---|
3719 | 186 198 gm |
---|
3720 | -0.05102 0.(Create a new sequence. Prompts for sequence type, and short name.)ashow |
---|
3721 | 208 90 gm |
---|
3722 | -0.03674 0.(Import foreign format)ashow |
---|
3723 | 219 90 gm |
---|
3724 | -0.03681 0.(Export foreign format)ashow |
---|
3725 | 219 198 gm |
---|
3726 | -0.08541 0.(Load and save sequences using Readseq by Don Gilbert \(see Appendix C\).)ashow |
---|
3727 | 241 90 gm |
---|
3728 | -0.01116 0.(Save Selection)ashow |
---|
3729 | 241 198 gm |
---|
3730 | -0.08074 0.(Save the currently selected sequences in a specified file.)ashow |
---|
3731 | 263 90 gm |
---|
3732 | 0.34957 0. 32 0.03495 0.(Pretty print)awidthshow |
---|
3733 | 263 198 gm |
---|
3734 | -0.05415 0.(Print using the sequence formatter supplied by Readseq.)ashow |
---|
3735 | 285 90 gm |
---|
3736 | 0.35308 0. 32 0.03530 0.(Print Selection)awidthshow |
---|
3737 | 285 198 gm |
---|
3738 | 0.01174 0. 32 0.00117 0.(Print the selected sequences to the chosen printer. This function supports)awidthshow |
---|
3739 | 296 198 gm |
---|
3740 | 0.04150 0. 32 0.00415 0.(the Unix command enscript as well as lpr. The .GDEmenus file may need to)awidthshow |
---|
3741 | 307 198 gm |
---|
3742 | -0.00283 0.(be modified to add the names of local printers to the printer list.)ashow |
---|
3743 | 329 90 gm |
---|
3744 | 12 fz |
---|
3745 | 2 F /|______Times-Roman fnt |
---|
3746 | -0.20724 0.(Edit menu)ashow |
---|
3747 | 352 90 gm |
---|
3748 | 10 fz |
---|
3749 | 2 F /|______Times-Roman fnt |
---|
3750 | 0.25080 0.(sort...)ashow |
---|
3751 | 352 198 gm |
---|
3752 | -0.06867 0.(Sort the selected sequences by a primary and secondary key. Pass the new order)ashow |
---|
3753 | 363 198 gm |
---|
3754 | -0.00726 0.(to a new GDE window.)ashow |
---|
3755 | 385 90 gm |
---|
3756 | -0.14492 0.(Extract)ashow |
---|
3757 | 385 198 gm |
---|
3758 | -0.07679 0.(Extract the selected sequences into a new window.)ashow |
---|
3759 | 407 90 gm |
---|
3760 | 12 fz |
---|
3761 | 2 F /|______Times-Roman fnt |
---|
3762 | -0.24058 0.(DNA/RNA Menu)ashow |
---|
3763 | 419 90 gm |
---|
3764 | 10 fz |
---|
3765 | 2 F /|______Times-Roman fnt |
---|
3766 | -0.14962 0.(Translate)ashow |
---|
3767 | 419 198 gm |
---|
3768 | -0.05361 0.(Translate the selected sequences from DNA/RNA to Amino acid. The user can)ashow |
---|
3769 | 430 198 gm |
---|
3770 | -0.07470 0.(specify the desired reading frame, and the minimum open reading frame \(stop)ashow |
---|
3771 | 441 198 gm |
---|
3772 | -0.00601 0.(codon to stop codon\) to translate. The user can also choose between single)ashow |
---|
3773 | 452 198 gm |
---|
3774 | 0.00518 0. 32 0.00051 0.(letter code and triple letter codes. There is also an option to allow each ORF to)awidthshow |
---|
3775 | 463 198 gm |
---|
3776 | -0.11936 0.(to be entered as a seperate sequence.)ashow |
---|
3777 | 485 90 gm |
---|
3778 | 0.55633 0. 32 0.05563 0.(Dot plot)awidthshow |
---|
3779 | 485 198 gm |
---|
3780 | -0.02882 0.(Display a dotplot identity matrix for the selected sequence\(s\). If only one)ashow |
---|
3781 | 496 198 gm |
---|
3782 | (sequence is selected, then the dotplot is a self comparison. If two or more)show |
---|
3783 | 507 198 gm |
---|
3784 | -0.10966 0.(sequences are selected, then the first two sequences are compared.)ashow |
---|
3785 | 529 90 gm |
---|
3786 | 0.63247 0. 32 0.06324 0.(Clustal Align)awidthshow |
---|
3787 | 529 198 gm |
---|
3788 | 0.04074 0. 32 0.00407 0.(Align the selected sequences using the clustalv algorithm by Des Higgins.)awidthshow |
---|
3789 | 540 198 gm |
---|
3790 | -0.07983 0.(\(See Appendix C\))ashow |
---|
3791 | 562 90 gm |
---|
3792 | 0.29251 0. 32 0.02925 0.(Find All <meta f>)awidthshow |
---|
3793 | 562 198 gm |
---|
3794 | -0.04464 0.(Search and highlight the selected sequences for a given substring. A specified)ashow |
---|
3795 | 573 198 gm |
---|
3796 | -0.02334 0.(percent of mismatching can also be allowed.)ashow |
---|
3797 | 595 90 gm |
---|
3798 | 0.15136 0. 32 0.01513 0.(Variable Positions)awidthshow |
---|
3799 | 595 198 gm |
---|
3800 | -0.06744 0.(The selected sequences are scored column by column for conservation. The)ashow |
---|
3801 | 606 198 gm |
---|
3802 | 0.02929 0. 32 0.00292 0.(result is returned as a grey scale alignment color mask. This can be useful)awidthshow |
---|
3803 | 617 198 gm |
---|
3804 | 0.41549 0. 32 0.04154 0.(in selecting PCR primers.)awidthshow |
---|
3805 | 639 90 gm |
---|
3806 | -0.09349 0.(Sequence Consensus)ashow |
---|
3807 | 639 198 gm |
---|
3808 | -0.02246 0.(Return the consensus for the selected sequences. This can either be a majority)ashow |
---|
3809 | 650 198 gm |
---|
3810 | 0.17730 0. 32 0.01773 0.(consensus, or an ambiguity consensus using IUPAC coding.)awidthshow |
---|
3811 | 672 90 gm |
---|
3812 | -0.01284 0.(Distance Matrix )ashow |
---|
3813 | 672 198 gm |
---|
3814 | -0.07553 0.(Calculate a distance matrix for the selected sequences. \(See Appendix C\))ashow |
---|
3815 | 694 90 gm |
---|
3816 | (MFOLD)show |
---|
3817 | 694 198 gm |
---|
3818 | -0.01577 0.(Fold the selected sequences using MFOLD by Michael Zuker. The resulting)ashow |
---|
3819 | 705 198 gm |
---|
3820 | -0.08619 0.(structure is returned as a nested bracket \('[]'\) representation of the secondary)ashow |
---|
3821 | 716 198 gm |
---|
3822 | -0.05360 0.(structure.\(See appendix C.\))ashow |
---|
3823 | F T cp |
---|
3824 | %%Page: ? 12 |
---|
3825 | op |
---|
3826 | 31 30 xl |
---|
3827 | 1 1 pen |
---|
3828 | 753 90 gm |
---|
3829 | (nc 31 30 761 582 6 rc)kp |
---|
3830 | 1 setTxMode |
---|
3831 | 0 fs |
---|
3832 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
3833 | 7 fz |
---|
3834 | 2 F /|______Times-Roman fnt |
---|
3835 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
3836 | 753 300 gm |
---|
3837 | 12 fz |
---|
3838 | 2 F /|______Times-Roman fnt |
---|
3839 | (12)show |
---|
3840 | 92 90 gm |
---|
3841 | 10 fz |
---|
3842 | 2 F /|______Times-Roman fnt |
---|
3843 | -0.11444 0.(Draw Secondary Struct)ashow |
---|
3844 | 92 198 gm |
---|
3845 | -0.07971 0.(Draw the selected sequence using the proposed secondary structure. Both the)ashow |
---|
3846 | 103 198 gm |
---|
3847 | -0.11421 0.(secondary structure prediction, and the RNA sequence should be selected before)ashow |
---|
3848 | 114 198 gm |
---|
3849 | 0.08117 0. 32 0.00811 0.(calling this function. The drawing program is LoopTool. \(See Appendix C\))awidthshow |
---|
3850 | 136 90 gm |
---|
3851 | 0.39718 0. 32 0.03971 0.(Highlight Helix)awidthshow |
---|
3852 | 136 198 gm |
---|
3853 | -0.02478 0.(Show all violations to a proposed RNA secondary structure. The secondary)ashow |
---|
3854 | 147 198 gm |
---|
3855 | -0.06376 0.(structure represented must be selected, as well as the aligned sequences to be)ashow |
---|
3856 | 158 198 gm |
---|
3857 | -0.06709 0.(tested. The selected sequences will then be colored according to whether or not)ashow |
---|
3858 | 169 198 gm |
---|
3859 | -0.02209 0.(they support the proposed 2)ashow |
---|
3860 | currentfont SwToSym |
---|
3861 | -0.02209 0.(\260)ashow |
---|
3862 | setfont |
---|
3863 | -0.02209 0.( structure. Standard Watson/Crick paring will be)ashow |
---|
3864 | 180 198 gm |
---|
3865 | (colored dark blue, G-U paring will be colored light blue, mismatches will be)show |
---|
3866 | 191 198 gm |
---|
3867 | -0.03656 0.(colored gold, and pairng to gaps will be red.)ashow |
---|
3868 | 213 90 gm |
---|
3869 | -0.09217 0.(Blastn/BlastX)ashow |
---|
3870 | 213 198 gm |
---|
3871 | -0.06690 0.(Search the selected sequence \(select only one\) against a given database with the)ashow |
---|
3872 | 224 198 gm |
---|
3873 | 0.21972 0. 32 0.02197 0.(BLAST searching tool written by Altschul, Gish, Miller, Myers, and Lipman.)awidthshow |
---|
3874 | 235 198 gm |
---|
3875 | -0.05590 0.(Blastn searches DNA against DNA databases, blastx searches DNA against AA)ashow |
---|
3876 | 246 198 gm |
---|
3877 | -0.04621 0.(databases by translating the sequence in all six reading frames. \(See Appendix C\))ashow |
---|
3878 | 268 90 gm |
---|
3879 | 0.02897 0.(FastA)ashow |
---|
3880 | 268 198 gm |
---|
3881 | -0.06472 0.(Search the selected sequence \(select only one\) against a given database using the)ashow |
---|
3882 | 279 198 gm |
---|
3883 | 0.02075 0. 32 0.00207 0.(FASTA similarity search program written by Pearson and Lipman. \(See)awidthshow |
---|
3884 | 290 198 gm |
---|
3885 | -0.09335 0.(Appendix C\))ashow |
---|
3886 | 312 90 gm |
---|
3887 | 12 fz |
---|
3888 | 2 F /|______Times-Roman fnt |
---|
3889 | -0.15008 0.(Protein Menu)ashow |
---|
3890 | 346 90 gm |
---|
3891 | 10 fz |
---|
3892 | 2 F /|______Times-Roman fnt |
---|
3893 | 0.63247 0. 32 0.06324 0.(Clustal Align)awidthshow |
---|
3894 | 346 198 gm |
---|
3895 | -0.02090 0.(Align the selected amino acid sequences using the clustal algorithm. \(See)ashow |
---|
3896 | 357 198 gm |
---|
3897 | -0.09335 0.(Appendix C\))ashow |
---|
3898 | 379 90 gm |
---|
3899 | 0.21408 0. 32 0.02140 0.(Blastp, Tblastn, Blast3)awidthshow |
---|
3900 | 379 198 gm |
---|
3901 | -0.06690 0.(Search the selected sequence \(select only one\) against a given database with the)ashow |
---|
3902 | 390 198 gm |
---|
3903 | 0.21972 0. 32 0.02197 0.(BLAST searching tool written by Altschul, Gish, Miller, Myers, and Lipman.)awidthshow |
---|
3904 | 401 198 gm |
---|
3905 | -0.04742 0.(Blastp searches AA against AA databases, tblastn searches AA against DNA)ashow |
---|
3906 | 412 198 gm |
---|
3907 | -0.03672 0.(databases by translating the database in all six reading frames. Blast3 finds)ashow |
---|
3908 | 423 198 gm |
---|
3909 | 0.00274 0. 32 0.00027 0.(three way alignments that are could not be found with only pairwise comparisons.)awidthshow |
---|
3910 | 434 198 gm |
---|
3911 | -0.07983 0.(\(See Appendix C\))ashow |
---|
3912 | 456 90 gm |
---|
3913 | 12 fz |
---|
3914 | 2 F /|______Times-Roman fnt |
---|
3915 | -0.20037 0.(Sequence Management Menu)ashow |
---|
3916 | 479 90 gm |
---|
3917 | 10 fz |
---|
3918 | 2 F /|______Times-Roman fnt |
---|
3919 | 0.07385 0. 32 0.00738 0.(Assemble contigs)awidthshow |
---|
3920 | 479 198 gm |
---|
3921 | 0.02410 0. 32 0.00241 0.(Assemble the selected sequences into contigs using the program CAP \(Contig)awidthshow |
---|
3922 | 490 198 gm |
---|
3923 | -0.03036 0.(Assemble Program\) written by Xiaoqiu Huang. The resulting sequences are)ashow |
---|
3924 | 501 198 gm |
---|
3925 | -0.03370 0.(returned to the current GDE window, and they are grouped into contigs. The)ashow |
---|
3926 | 512 198 gm |
---|
3927 | -0.05517 0.(user can then sort the sequences by group, and offset to produce an ordered list of)ashow |
---|
3928 | 523 198 gm |
---|
3929 | 0.02960 0. 32 0.00296 0.(the contigs. \(See Appendix C\))awidthshow |
---|
3930 | 545 90 gm |
---|
3931 | -0.02136 0.(Strategy view)ashow |
---|
3932 | 545 198 gm |
---|
3933 | 0.03570 0. 32 0.00357 0.(Pass out the selected sequences to StratView. This program will display contigs)awidthshow |
---|
3934 | 556 198 gm |
---|
3935 | -0.01431 0.(in a greatly reduced line drawing. This is very useful for large contigs.)ashow |
---|
3936 | 578 90 gm |
---|
3937 | 0.32684 0. 32 0.03268 0.(Restriction sites)awidthshow |
---|
3938 | 578 198 gm |
---|
3939 | -0.06761 0.(Search the selected sequences for the restriction enzymes specified in the given)ashow |
---|
3940 | 589 198 gm |
---|
3941 | -0.01243 0.(enzyme file. The restriction sites are then colored by enzyme.)ashow |
---|
3942 | 611 90 gm |
---|
3943 | 12 fz |
---|
3944 | 2 F /|______Times-Roman fnt |
---|
3945 | -0.07624 0.(Phylogeny menu)ashow |
---|
3946 | 635 90 gm |
---|
3947 | 10 fz |
---|
3948 | 2 F /|______Times-Roman fnt |
---|
3949 | -0.07130 0.(DeSoete Tree fit)ashow |
---|
3950 | 635 198 gm |
---|
3951 | -0.00927 0.(Calculate a phylogenetic tree using a least squares fitting algorithm on a distance)ashow |
---|
3952 | 646 198 gm |
---|
3953 | -0.06059 0.(matrix calculated from the selected sequences. The results can then be passed on)ashow |
---|
3954 | 657 198 gm |
---|
3955 | -0.01338 0.(to treetool for display and manipulation. \(See Appendix C\))ashow |
---|
3956 | 679 90 gm |
---|
3957 | 0.99151 0. 32 0.09915 0.(Phylip 3.5)awidthshow |
---|
3958 | 679 198 gm |
---|
3959 | 0.10299 0. 32 0.01029 0.(Pass the selected data to on of the treeing programs in Phylip, written by)awidthshow |
---|
3960 | 690 198 gm |
---|
3961 | 0.16418 0. 32 0.01641 0.(Joe Felsenstein. The chosen phylip program is started in it's own window,)awidthshow |
---|
3962 | 701 198 gm |
---|
3963 | -0.12712 0.(with the selected sequences already loaded. \(See Appendix C\))ashow |
---|
3964 | F T cp |
---|
3965 | %%Page: ? 13 |
---|
3966 | op |
---|
3967 | 31 30 xl |
---|
3968 | 1 1 pen |
---|
3969 | 753 90 gm |
---|
3970 | (nc 31 30 761 582 6 rc)kp |
---|
3971 | 1 setTxMode |
---|
3972 | 0 fs |
---|
3973 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
3974 | 7 fz |
---|
3975 | 2 F /|______Times-Roman fnt |
---|
3976 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
3977 | 753 300 gm |
---|
3978 | 12 fz |
---|
3979 | 2 F /|______Times-Roman fnt |
---|
3980 | (13)show |
---|
3981 | 106 90 gm |
---|
3982 | 14 fz |
---|
3983 | 2 F /|______Times-Roman fnt |
---|
3984 | 0.70434 0. 32 0.07043 0.(Citation of work)awidthshow |
---|
3985 | 129 90 gm |
---|
3986 | 10 fz |
---|
3987 | 2 F /|______Times-Roman fnt |
---|
3988 | 0.03417 0. 32 0.00341 0.(We ask that any published work using any of the external functions in GDE cite the appropriate authors.)awidthshow |
---|
3989 | 140 90 gm |
---|
3990 | -0.08705 0.(Please see Appendix C for references.)ashow |
---|
3991 | 187 90 gm |
---|
3992 | 14 fz |
---|
3993 | 2 F /|______Times-Roman fnt |
---|
3994 | 0.42251 0. 32 0.04225 0.(Bug reports/extensions)awidthshow |
---|
3995 | 210 90 gm |
---|
3996 | 10 fz |
---|
3997 | 2 F /|______Times-Roman fnt |
---|
3998 | -0.04759 0.(Any bug reports, request for enhancement, and useful extensions to the GDE should be forwarded by)ashow |
---|
3999 | 221 90 gm |
---|
4000 | 0.06652 0. 32 0.00665 0.(electronic mail to:)awidthshow |
---|
4001 | 243 90 gm |
---|
4002 | 0.05484 0.(smith@bioimage.millipore.com)ashow |
---|
4003 | 265 90 gm |
---|
4004 | -0.01402 0.(Please include as much detail as possible in bug reports so that the bug can be reproduced.)ashow |
---|
4005 | 276 90 gm |
---|
4006 | -0.16358 0.(Correspondence should be addressed to:)ashow |
---|
4007 | 298 90 gm |
---|
4008 | 0.66253 0. 32 0.06625 0.(Steven Smith)awidthshow |
---|
4009 | 309 90 gm |
---|
4010 | 0.35827 0. 32 0.03582 0.(Millipore Imaging Systems)awidthshow |
---|
4011 | 320 90 gm |
---|
4012 | 0.17898 0. 32 0.01789 0.(777 E. Eisenhower Pkwy)awidthshow |
---|
4013 | 331 90 gm |
---|
4014 | 0.05920 0. 32 0.00592 0.(Ann Arbor, MI)awidthshow |
---|
4015 | 331 162 gm |
---|
4016 | (48108)show |
---|
4017 | 433 90 gm |
---|
4018 | 14 fz |
---|
4019 | 2 F /|______Times-Roman fnt |
---|
4020 | -0.06921 0.(Acknowledgments)ashow |
---|
4021 | 456 90 gm |
---|
4022 | 10 fz |
---|
4023 | 2 F /|______Times-Roman fnt |
---|
4024 | -0.01979 0.(I would like to thank the following people for their input and assistance and code used in the development of)ashow |
---|
4025 | 467 90 gm |
---|
4026 | (the GDE:)show |
---|
4027 | 489 90 gm |
---|
4028 | 0.10726 0. 32 0.01072 0.(Carl Woese, Gary Olsen and Mike Maciukenas at University of Illinois Dept of Microbiology, Ross)awidthshow |
---|
4029 | 500 90 gm |
---|
4030 | 0.00534 0. 32 0.00053 0.(Overbeek at Argonne National Laboratories,Walter Gilbert, Patrick Gillevet, Chunwei Wang, Susan Russo)awidthshow |
---|
4031 | 511 90 gm |
---|
4032 | -0.01847 0.(and Erik Bunce at the Harvard Genome Laboratory. I would also like to personally thank the following)ashow |
---|
4033 | 522 90 gm |
---|
4034 | 0.00961 0. 32 0.00096 0.(people for their permission to include their software with this release of GDE.)awidthshow |
---|
4035 | 544 90 gm |
---|
4036 | 0.60729 0. 32 0.06072 0.(Tim Littlejohn)awidthshow |
---|
4037 | 555 90 gm |
---|
4038 | 0.31784 0. 32 0.03178 0.(Scott Ferguson)awidthshow |
---|
4039 | 566 90 gm |
---|
4040 | -0.02497 0.(Brian Fristensky)ashow |
---|
4041 | 577 90 gm |
---|
4042 | 0.14419 0. 32 0.01441 0.(Des Higgins)awidthshow |
---|
4043 | 588 90 gm |
---|
4044 | -0.04928 0.(David Lipman and the group at NCBI)ashow |
---|
4045 | 599 90 gm |
---|
4046 | 0.03280 0. 32 0.00328 0.(William Pearson)awidthshow |
---|
4047 | 610 90 gm |
---|
4048 | (Don Gilbert)show |
---|
4049 | 621 90 gm |
---|
4050 | -0.11433 0.(Xiaoqui Huang)ashow |
---|
4051 | 632 90 gm |
---|
4052 | 0.07690 0. 32 0.00769 0.(Joe Felsenstein)awidthshow |
---|
4053 | 643 90 gm |
---|
4054 | -0.09466 0.(Michael Zuker)ashow |
---|
4055 | 654 90 gm |
---|
4056 | -0.13116 0.(Geert DeSoete)ashow |
---|
4057 | 687 90 gm |
---|
4058 | 0.02197 0. 32 0.00219 0.(Many thanks to all the people who have directly and indirectly helped with the ongoing support of GDE. It)awidthshow |
---|
4059 | 698 90 gm |
---|
4060 | 0.09597 0. 32 0.00959 0.(is only by the generosity of these people that GDE has been successful.)awidthshow |
---|
4061 | F T cp |
---|
4062 | %%Page: ? 14 |
---|
4063 | op |
---|
4064 | 31 30 xl |
---|
4065 | 1 1 pen |
---|
4066 | 753 90 gm |
---|
4067 | (nc 31 30 761 582 6 rc)kp |
---|
4068 | 1 setTxMode |
---|
4069 | 0 fs |
---|
4070 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4071 | 7 fz |
---|
4072 | 2 F /|______Times-Roman fnt |
---|
4073 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
4074 | 753 300 gm |
---|
4075 | 12 fz |
---|
4076 | 2 F /|______Times-Roman fnt |
---|
4077 | (14)show |
---|
4078 | 95 90 gm |
---|
4079 | 14 fz |
---|
4080 | 2 F /|______Times-Roman fnt |
---|
4081 | 0.57128 0. 32 0.05712 0.(Appendix A, File Formats)awidthshow |
---|
4082 | 122 90 gm |
---|
4083 | 10 fz |
---|
4084 | 2 F /|______Times-Roman fnt |
---|
4085 | -0.03565 0.(The currently supported file formats include GDE data files, Genbank formatted files \(with type extensions\),)ashow |
---|
4086 | 133 90 gm |
---|
4087 | -0.01033 0.(a generic flat file format, and a color mask file.)ashow |
---|
4088 | 155 90 gm |
---|
4089 | 12 fz |
---|
4090 | 2 F /|______Times-Roman fnt |
---|
4091 | -0.18190 0.(GDE format)ashow |
---|
4092 | 167 90 gm |
---|
4093 | 10 fz |
---|
4094 | 2 F /|______Times-Roman fnt |
---|
4095 | -0.02778 0.(GDE format is a tagged field format used for storing all available information about a sequence. The format)ashow |
---|
4096 | 178 90 gm |
---|
4097 | -0.03959 0.(matches very closely the GDE internal structures for sequence data. The format consists of text records)ashow |
---|
4098 | 189 90 gm |
---|
4099 | -0.08013 0.(starting and ending with braces \('{}'\). Between the open and close braces are several tagged field lines)ashow |
---|
4100 | 200 90 gm |
---|
4101 | -0.04377 0.(specifying different pieces of information about a given sequence. The tag values can be wrapped with)ashow |
---|
4102 | 211 90 gm |
---|
4103 | -0.05966 0.(double quote characters \('""'\) as needed. If quotes are not used, the first whitespace delimited string is taken)ashow |
---|
4104 | 222 90 gm |
---|
4105 | -0.03451 0.(as the value. The allowable fields are:)ashow |
---|
4106 | 244 90 gm |
---|
4107 | ({)show |
---|
4108 | 255 90 gm |
---|
4109 | -0.21841 0.(name)ashow |
---|
4110 | 255 162 gm |
---|
4111 | -0.09494 0.("Short name for sequence")ashow |
---|
4112 | 266 90 gm |
---|
4113 | -0.06198 0.(longname)ashow |
---|
4114 | 266 162 gm |
---|
4115 | -0.11402 0.("Long \(more descriptive\) name for sequence")ashow |
---|
4116 | 277 90 gm |
---|
4117 | -0.35173 0.(sequence-ID)ashow |
---|
4118 | 277 162 gm |
---|
4119 | -0.09922 0.("Unique ID number")ashow |
---|
4120 | 288 90 gm |
---|
4121 | -0.26521 0.(creation-date)ashow |
---|
4122 | 288 162 gm |
---|
4123 | 0.12008 0. 32 0.01200 0.("mm/dd/yy hh:mm:ss")awidthshow |
---|
4124 | 299 90 gm |
---|
4125 | -0.19244 0.(direction)ashow |
---|
4126 | 299 162 gm |
---|
4127 | -0.19648 0.([-1|1])ashow |
---|
4128 | 310 90 gm |
---|
4129 | -0.28077 0.(strandedness)ashow |
---|
4130 | 310 162 gm |
---|
4131 | -0.16368 0.([1|2])ashow |
---|
4132 | 321 90 gm |
---|
4133 | -0.07225 0.(type)ashow |
---|
4134 | 321 162 gm |
---|
4135 | -0.07638 0.([DNA|RNA||PROTEIN|TEXT|MASK])ashow |
---|
4136 | 332 90 gm |
---|
4137 | -0.15226 0.(offset)ashow |
---|
4138 | 332 162 gm |
---|
4139 | -0.03222 0.(\(-999999,999999\))ashow |
---|
4140 | 343 90 gm |
---|
4141 | -0.17175 0.(group-ID)ashow |
---|
4142 | 343 162 gm |
---|
4143 | -0.02587 0.(\(0,999\))ashow |
---|
4144 | 354 90 gm |
---|
4145 | -0.29151 0.(creator)ashow |
---|
4146 | 354 162 gm |
---|
4147 | -0.02342 0.("Author's name")ashow |
---|
4148 | 365 90 gm |
---|
4149 | -0.31198 0.(descrip)ashow |
---|
4150 | 365 162 gm |
---|
4151 | -0.12005 0.("Verbose description")ashow |
---|
4152 | 376 90 gm |
---|
4153 | -0.01441 0.(comments)ashow |
---|
4154 | 376 162 gm |
---|
4155 | -0.01306 0.("Lines of comments that can be fairly arbitrary)ashow |
---|
4156 | 387 90 gm |
---|
4157 | -0.03907 0.(text about a sequence. Return characters are allowed, but no internal)ashow |
---|
4158 | 398 90 gm |
---|
4159 | -0.05203 0.(double quotes or brace characters. Remember to close with a double)ashow |
---|
4160 | 409 90 gm |
---|
4161 | -0.25929 0.(quote")ashow |
---|
4162 | 420 90 gm |
---|
4163 | -0.37757 0.(sequence)ashow |
---|
4164 | 420 162 gm |
---|
4165 | -0.11505 0.("gctagctagctagctagctcttagctgtagtcgtagctgatgctagct)ashow |
---|
4166 | 431 90 gm |
---|
4167 | -0.13807 0.(gatgctagctagctagctagctgatcgatgctagctgatcgtagctgacg)ashow |
---|
4168 | 442 90 gm |
---|
4169 | -0.09281 0.(gactgatgctagctagctagctagctgtctagtgtcgtagtgcttattgc")ashow |
---|
4170 | 453 90 gm |
---|
4171 | (})show |
---|
4172 | 475 90 gm |
---|
4173 | -0.03117 0.(Any fields that are not specified are assumed to be the default values. Offsets can be negative as well as)ashow |
---|
4174 | 486 90 gm |
---|
4175 | -0.00729 0.(positive. Genbank entries written out in this format will have all \("\) converted to \('\), and all \({}\) converted)ashow |
---|
4176 | 497 90 gm |
---|
4177 | -0.03678 0.(to \([]\) to avoid confusion in the parser. Leading and trailing gaps are removed prior to writing each sequence.)ashow |
---|
4178 | 508 90 gm |
---|
4179 | -0.00801 0.(This format is deliberately verbose in order to be simple to duplicate.)ashow |
---|
4180 | 541 90 gm |
---|
4181 | 12 fz |
---|
4182 | 2 F /|______Times-Roman fnt |
---|
4183 | -0.11645 0.(Genbank format:)ashow |
---|
4184 | 553 90 gm |
---|
4185 | 10 fz |
---|
4186 | 2 F /|______Times-Roman fnt |
---|
4187 | -0.06373 0.(GDE can read a concatenated list of Genbank entries, and extract certain fields from such files. The default)ashow |
---|
4188 | 564 90 gm |
---|
4189 | (method for storing nucleic acid, amino acid, masking sequences or text is in Genbank format. The following)show |
---|
4190 | 575 90 gm |
---|
4191 | -0.19308 0.(fields are recognized:)ashow |
---|
4192 | 597 90 gm |
---|
4193 | {}mark T /Courier /|______Courier 0 rf |
---|
4194 | 7 fz |
---|
4195 | 2 F /|______Courier fnt |
---|
4196 | -0.23880 0.(LOCUS:)ashow |
---|
4197 | 597 162 gm |
---|
4198 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4199 | 10 fz |
---|
4200 | 2 F /|______Times-Roman fnt |
---|
4201 | -0.04878 0.(Short name for this sequence \(Maximum of 32 characters\))ashow |
---|
4202 | 0 -3 rm |
---|
4203 | 7 fz |
---|
4204 | 2 F /|______Times-Roman fnt |
---|
4205 | (\240)show |
---|
4206 | 608 90 gm |
---|
4207 | {}mark T /Courier /|______Courier 0 rf |
---|
4208 | 2 F /|______Courier fnt |
---|
4209 | -0.21890 0.(DEFINITION:)ashow |
---|
4210 | 608 162 gm |
---|
4211 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4212 | 10 fz |
---|
4213 | 2 F /|______Times-Roman fnt |
---|
4214 | -0.06732 0.(Definition of sequence \(Maximum of 80 characters\))ashow |
---|
4215 | 619 90 gm |
---|
4216 | {}mark T /Courier /|______Courier 0 rf |
---|
4217 | 7 fz |
---|
4218 | 2 F /|______Courier fnt |
---|
4219 | -0.22387 0.(ORGANISM:)ashow |
---|
4220 | 619 198 gm |
---|
4221 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4222 | 10 fz |
---|
4223 | 2 F /|______Times-Roman fnt |
---|
4224 | (Full name of organism \(Maximum of 80 characters\))show |
---|
4225 | 630 90 gm |
---|
4226 | {}mark T /Courier /|______Courier 0 rf |
---|
4227 | 7 fz |
---|
4228 | 2 F /|______Courier fnt |
---|
4229 | -0.22743 0.(AUTHORS:)ashow |
---|
4230 | 630 198 gm |
---|
4231 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4232 | 10 fz |
---|
4233 | 2 F /|______Times-Roman fnt |
---|
4234 | -0.04580 0.(Authors of this sequence \(Maximum of 80 characters\))ashow |
---|
4235 | 641 90 gm |
---|
4236 | {}mark T /Courier /|______Courier 0 rf |
---|
4237 | 7 fz |
---|
4238 | 2 F /|______Courier fnt |
---|
4239 | -0.22111 0.(ACCESSION:)ashow |
---|
4240 | 641 162 gm |
---|
4241 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4242 | 10 fz |
---|
4243 | 2 F /|______Times-Roman fnt |
---|
4244 | -0.06069 0.(ID Number for this sequence \(Maximum of 80 characters\))ashow |
---|
4245 | 652 90 gm |
---|
4246 | {}mark T /Courier /|______Courier 0 rf |
---|
4247 | 7 fz |
---|
4248 | 2 F /|______Courier fnt |
---|
4249 | -0.23217 0.(ORIGIN:)ashow |
---|
4250 | 652 162 gm |
---|
4251 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4252 | 10 fz |
---|
4253 | 2 F /|______Times-Roman fnt |
---|
4254 | -0.16001 0.(Beginning of sequence data)ashow |
---|
4255 | 0 -3 rm |
---|
4256 | 7 fz |
---|
4257 | 2 F /|______Times-Roman fnt |
---|
4258 | (\240)show |
---|
4259 | 663 90 gm |
---|
4260 | {}mark T /Courier /|______Courier 0 rf |
---|
4261 | 2 F /|______Courier fnt |
---|
4262 | -0.39801 0.(//)ashow |
---|
4263 | 663 198 gm |
---|
4264 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4265 | 10 fz |
---|
4266 | 2 F /|______Times-Roman fnt |
---|
4267 | -0.22740 0.(End of sequence data)ashow |
---|
4268 | 0 -3 rm |
---|
4269 | 7 fz |
---|
4270 | 2 F /|______Times-Roman fnt |
---|
4271 | (\240)show |
---|
4272 | -4096 -4096 gm |
---|
4273 | 0 gr |
---|
4274 | -4095 -4095 lin |
---|
4275 | 6 25 lw |
---|
4276 | 680 90 gm |
---|
4277 | 680 233 lin |
---|
4278 | 25 6 lw |
---|
4279 | 1 1 lw |
---|
4280 | 693 90 gm |
---|
4281 | 1 setTxMode |
---|
4282 | 9 fz |
---|
4283 | 2 F /|______Times-Roman fnt |
---|
4284 | -0.03189 0.(\240 Required field)ashow |
---|
4285 | F T cp |
---|
4286 | %%Page: ? 15 |
---|
4287 | op |
---|
4288 | 31 30 xl |
---|
4289 | 1 1 pen |
---|
4290 | 753 90 gm |
---|
4291 | (nc 31 30 761 582 6 rc)kp |
---|
4292 | 1 setTxMode |
---|
4293 | 0 fs |
---|
4294 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4295 | 7 fz |
---|
4296 | 2 F /|______Times-Roman fnt |
---|
4297 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
4298 | 753 300 gm |
---|
4299 | 12 fz |
---|
4300 | 2 F /|______Times-Roman fnt |
---|
4301 | (15)show |
---|
4302 | 92 90 gm |
---|
4303 | 10 fz |
---|
4304 | 2 F /|______Times-Roman fnt |
---|
4305 | 0.01617 0. 32 0.00161 0.(All other lines are retained as comments. The LOCUS line also specifies what type of sequence follows.)awidthshow |
---|
4306 | 103 90 gm |
---|
4307 | 0.31143 0. 32 0.03114 0.(The form of this line is:)awidthshow |
---|
4308 | 122 90 gm |
---|
4309 | {}mark T /Courier /|______Courier 0 rf |
---|
4310 | 7 fz |
---|
4311 | 2 F /|______Courier fnt |
---|
4312 | -0.19900 0.(LOCUS )ashow |
---|
4313 | 2 fs |
---|
4314 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4315 | 2 F /|______Courier-Oblique fnt |
---|
4316 | -0.26533 0.(name)ashow |
---|
4317 | 122 198 gm |
---|
4318 | -0.19900 0.(size)ashow |
---|
4319 | 0 fs |
---|
4320 | 2 F /|______Courier fnt |
---|
4321 | -0.29850 0.( bp)ashow |
---|
4322 | 122 234 gm |
---|
4323 | 2 fs |
---|
4324 | 2 F /|______Courier-Oblique fnt |
---|
4325 | -0.26533 0.(type)ashow |
---|
4326 | 122 270 gm |
---|
4327 | -0.26533 0.(date)ashow |
---|
4328 | 144 90 gm |
---|
4329 | 0 fs |
---|
4330 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4331 | 10 fz |
---|
4332 | 2 F /|______Times-Roman fnt |
---|
4333 | 0.23757 0. 32 0.02375 0.(where )awidthshow |
---|
4334 | 2 fs |
---|
4335 | {}mark T /Times-Italic /|______Times-Italic 0 rf |
---|
4336 | 2 F /|______Times-Italic fnt |
---|
4337 | 0.07641 0.(name)ashow |
---|
4338 | 0 fs |
---|
4339 | 2 F /|______Times-Roman fnt |
---|
4340 | 0.19012 0. 32 0.01901 0.( is the Genbank Locus name, )awidthshow |
---|
4341 | 2 fs |
---|
4342 | 2 F /|______Times-Italic fnt |
---|
4343 | 0.16464 0. 32 0.01646 0.(size )awidthshow |
---|
4344 | 0 fs |
---|
4345 | 2 F /|______Times-Roman fnt |
---|
4346 | 0.17791 0. 32 0.01779 0.(is total base count, )awidthshow |
---|
4347 | 2 fs |
---|
4348 | 2 F /|______Times-Italic fnt |
---|
4349 | 0.05877 0.(type)ashow |
---|
4350 | 0 fs |
---|
4351 | 2 F /|______Times-Roman fnt |
---|
4352 | 0.21957 0. 32 0.02195 0.( is one of DNA, RNA, PROTEIN,)awidthshow |
---|
4353 | 155 90 gm |
---|
4354 | -0.03018 0.(MASK, or TEXT and )ashow |
---|
4355 | 2 fs |
---|
4356 | 2 F /|______Times-Italic fnt |
---|
4357 | -0.02607 0.(date)ashow |
---|
4358 | 0 fs |
---|
4359 | 2 F /|______Times-Roman fnt |
---|
4360 | -0.02537 0.( is of the form dd-MON-yyyy. In this way, the standard Genbank format is)ashow |
---|
4361 | 166 90 gm |
---|
4362 | -0.06455 0.(extended to store all text, mask and protein data. The Genbank character set has also been extended in order)ashow |
---|
4363 | 177 90 gm |
---|
4364 | -0.04171 0.(to support these other data types. Valid characters are:)ashow |
---|
4365 | 199 90 gm |
---|
4366 | -0.04614 0.(DNA/RNA:)ashow |
---|
4367 | 199 198 gm |
---|
4368 | -0.00355 0.(Full IUPAC coding as well as '-' and '~' characters for alignment)ashow |
---|
4369 | 210 198 gm |
---|
4370 | -0.10925 0.(gaps)ashow |
---|
4371 | 221 90 gm |
---|
4372 | 0.04852 0.(Protein:)ashow |
---|
4373 | 221 198 gm |
---|
4374 | -0.01260 0.(All valid single letter codes plus '-' and '~'. Other ASCII characters)ashow |
---|
4375 | 232 198 gm |
---|
4376 | -0.04739 0.(may be inserted, however external functions may be confused by)ashow |
---|
4377 | 243 198 gm |
---|
4378 | -0.12287 0.(such characters.)ashow |
---|
4379 | 254 90 gm |
---|
4380 | (Mask:)show |
---|
4381 | 254 198 gm |
---|
4382 | 0.01281 0. 32 0.00128 0.(All legal printable ASCII characters. If used as a selection mask, all)awidthshow |
---|
4383 | 265 198 gm |
---|
4384 | 0.12207 0. 32 0.01220 0.(columns containing a '0' will be removed from any analysis.)awidthshow |
---|
4385 | 276 90 gm |
---|
4386 | -0.02584 0.(Text:)ashow |
---|
4387 | 276 198 gm |
---|
4388 | -0.05348 0.(All valid ASCII characters.)ashow |
---|
4389 | 298 90 gm |
---|
4390 | 0.05142 0. 32 0.00514 0.(Here is a valid Genbank entry for two E.coli tRNA's:)awidthshow |
---|
4391 | 317 90 gm |
---|
4392 | {}mark T /Courier /|______Courier 0 rf |
---|
4393 | 7 fz |
---|
4394 | 2 F /|______Courier fnt |
---|
4395 | -0.20202 0.(LOCUS ECOTRNT4 76 bp RNA 28-JAN-1991)ashow |
---|
4396 | 325 90 gm |
---|
4397 | -0.20275 0.(DEFINITION E. coli \(T4 infected\) vulnerable tRNA \(A\).)ashow |
---|
4398 | 333 90 gm |
---|
4399 | -0.20637 0.( ORGANISM Escherichia coli)ashow |
---|
4400 | 341 90 gm |
---|
4401 | -0.20315 0.( AUTHORS Amitsur,M., Levitz,R. and Kaufmann,G.)ashow |
---|
4402 | 349 90 gm |
---|
4403 | -0.20362 0.(FEATURES From To/Span Description)ashow |
---|
4404 | 357 90 gm |
---|
4405 | -0.20298 0.( tRNA 1 76 vulnerable tRNA\(A\))ashow |
---|
4406 | 365 90 gm |
---|
4407 | -0.21559 0.(BASE COUNT ?)ashow |
---|
4408 | 373 90 gm |
---|
4409 | -0.23880 0.(ORIGIN)ashow |
---|
4410 | 381 90 gm |
---|
4411 | -0.20169 0.( 1 GGGUCGUUAG CUCAGUUGGU AGAGCAGUUG ACUUUUAAUC AAUUGGNCGC AGGUUCGAAU)ashow |
---|
4412 | 389 90 gm |
---|
4413 | -0.20666 0.( 61 CCUGCACGAC CCACCA)ashow |
---|
4414 | 397 90 gm |
---|
4415 | -0.39801 0.(//)ashow |
---|
4416 | 405 90 gm |
---|
4417 | -0.20202 0.(LOCUS ECOTRQ1 75 bp RNA 28-JAN-1991)ashow |
---|
4418 | 413 90 gm |
---|
4419 | -0.20587 0.(DEFINITION E.coli Gln-tRNA-1.)ashow |
---|
4420 | 421 90 gm |
---|
4421 | -0.20637 0.( ORGANISM Escherichia coli)ashow |
---|
4422 | 429 90 gm |
---|
4423 | -0.20503 0.( AUTHORS Yaniv,M. and Folk,W.R.)ashow |
---|
4424 | 437 90 gm |
---|
4425 | -0.20166 0.(SOURCE -REFERENCE [1] JOURNAL J. Biol. Chem. 250, 3243-3253 \(1975\))ashow |
---|
4426 | 445 90 gm |
---|
4427 | -0.20362 0.(FEATURES From To/Span Description)ashow |
---|
4428 | 453 90 gm |
---|
4429 | -0.20269 0.( tRNA 1 75 Gln-tRNA-1 \(NAR: 0510\))ashow |
---|
4430 | 461 90 gm |
---|
4431 | -0.20231 0.( refnumbr 1 1 sequence not numbered in [1])ashow |
---|
4432 | 469 90 gm |
---|
4433 | -0.21559 0.(BASE COUNT ?)ashow |
---|
4434 | 477 90 gm |
---|
4435 | -0.23880 0.(ORIGIN)ashow |
---|
4436 | 485 90 gm |
---|
4437 | -0.20169 0.( 1 UGGGGUAUCG CCAAGCGGUA AGGCACCGGU UUUUGAUACC GGCAUUCCCU GGUUCGAAUC)ashow |
---|
4438 | 493 90 gm |
---|
4439 | -0.20697 0.( 61 CAGGUACCCC AGCCA)ashow |
---|
4440 | 501 90 gm |
---|
4441 | -0.39801 0.(//)ashow |
---|
4442 | 534 90 gm |
---|
4443 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4444 | 12 fz |
---|
4445 | 2 F /|______Times-Roman fnt |
---|
4446 | -0.18539 0.(Flat file format:)ashow |
---|
4447 | 546 90 gm |
---|
4448 | 10 fz |
---|
4449 | 2 F /|______Times-Roman fnt |
---|
4450 | 0.11169 0. 32 0.01116 0.(This is a simplified format for importing sequence data, and passing it out to analysis functions. Very little)awidthshow |
---|
4451 | 557 90 gm |
---|
4452 | 0.02944 0. 32 0.00294 0.(information is actually retained in this format, and should be used carefully so as not to lose attribute)awidthshow |
---|
4453 | 568 90 gm |
---|
4454 | 0.03372 0. 32 0.00337 0.(information. It is defined as follow:)awidthshow |
---|
4455 | 587 90 gm |
---|
4456 | 2 fs |
---|
4457 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4458 | 7 fz |
---|
4459 | 2 F /|______Courier-Oblique fnt |
---|
4460 | -0.20729 0.(type_character short_name)ashow |
---|
4461 | 595 90 gm |
---|
4462 | -0.21559 0.(sequence_data)ashow |
---|
4463 | 603 90 gm |
---|
4464 | -0.21559 0.(sequence_data)ashow |
---|
4465 | 611 90 gm |
---|
4466 | -0.21559 0.(sequence_data)ashow |
---|
4467 | 619 90 gm |
---|
4468 | -0.29850 0.(...)ashow |
---|
4469 | 641 90 gm |
---|
4470 | 0 fs |
---|
4471 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4472 | 10 fz |
---|
4473 | 2 F /|______Times-Roman fnt |
---|
4474 | -0.02508 0.(The type character is # for DNA/RNA, % for protein sequence, @ for mask sequence, and " for text. The)ashow |
---|
4475 | 652 90 gm |
---|
4476 | 0.07781 0. 32 0.00778 0.(short name is the same as the LOCUS line in Genbank. This is followed by lines of sequence, each ending)awidthshow |
---|
4477 | 663 90 gm |
---|
4478 | -0.03877 0.(with a return character.These lines are read until the next type character is encountered, or until the end of the)ashow |
---|
4479 | 674 90 gm |
---|
4480 | -0.01963 0.(file is reached. Care should be taken in using this format with text as space characters are stripped)ashow |
---|
4481 | 685 90 gm |
---|
4482 | 0.03921 0. 32 0.00392 0.(automatically. As of release 2.0, flat file format allows for an optional offset to be specified in parentheses)awidthshow |
---|
4483 | 696 90 gm |
---|
4484 | -0.07716 0.(after the sequence name. An offset represents how many leading gap characters should be placed before the)ashow |
---|
4485 | 707 90 gm |
---|
4486 | 0.07568 0. 32 0.00756 0.(start of a sequence. If this offset does not exist, then it is defined to be 0.)awidthshow |
---|
4487 | F T cp |
---|
4488 | %%Page: ? 16 |
---|
4489 | op |
---|
4490 | 31 30 xl |
---|
4491 | 1 1 pen |
---|
4492 | 753 90 gm |
---|
4493 | (nc 31 30 761 582 6 rc)kp |
---|
4494 | 1 setTxMode |
---|
4495 | 0 fs |
---|
4496 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4497 | 7 fz |
---|
4498 | 2 F /|______Times-Roman fnt |
---|
4499 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
4500 | 753 300 gm |
---|
4501 | 12 fz |
---|
4502 | 2 F /|______Times-Roman fnt |
---|
4503 | (16)show |
---|
4504 | 81 90 gm |
---|
4505 | 10 fz |
---|
4506 | 2 F /|______Times-Roman fnt |
---|
4507 | 0.13809 0. 32 0.01380 0.(Here is a sample flat file for two Ecoli tRNA's:)awidthshow |
---|
4508 | 100 90 gm |
---|
4509 | {}mark T /Courier /|______Courier 0 rf |
---|
4510 | 7 fz |
---|
4511 | 2 F /|______Courier fnt |
---|
4512 | -0.22387 0.(#ECOTRNT4)ashow |
---|
4513 | 108 90 gm |
---|
4514 | -0.20237 0.(GGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGNCGCAGGUUCGAAU)ashow |
---|
4515 | 116 90 gm |
---|
4516 | -0.21226 0.(CCUGCACGACCCACCA)ashow |
---|
4517 | 124 90 gm |
---|
4518 | -0.22743 0.(#ECOTRQ1)ashow |
---|
4519 | 132 90 gm |
---|
4520 | -0.20237 0.(UGGGGUAUCGCCAAGCGGUAAGGCACCGGUUUUUGAUACCGGCAUUCCCUGGUUCGAAUC)ashow |
---|
4521 | 140 90 gm |
---|
4522 | -0.21322 0.(CAGGUACCCCAGCCA)ashow |
---|
4523 | 173 90 gm |
---|
4524 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4525 | 12 fz |
---|
4526 | 2 F /|______Times-Roman fnt |
---|
4527 | -0.09919 0.(Color mask:)ashow |
---|
4528 | 185 90 gm |
---|
4529 | 10 fz |
---|
4530 | 2 F /|______Times-Roman fnt |
---|
4531 | 0.10299 0. 32 0.01029 0.(The format for a color mask has been kept simple to make implementation of color functions easy. The)awidthshow |
---|
4532 | 196 90 gm |
---|
4533 | 0.05355 0. 32 0.00535 0.(format optionally defines which sequence to color, whether or not to color alignment gaps in the existing)awidthshow |
---|
4534 | 207 90 gm |
---|
4535 | 0.04089 0. 32 0.00408 0.(sequence, and how long the following mask will be. It is then followed by a list of decimal color codes)awidthshow |
---|
4536 | 218 90 gm |
---|
4537 | -0.01760 0.(\(range 0 to 15\) for each position in the sequence. There are four keywords used in the color mask file.)ashow |
---|
4538 | 229 90 gm |
---|
4539 | -0.12745 0.(Those keywords are:)ashow |
---|
4540 | 251 90 gm |
---|
4541 | {}mark T /Courier /|______Courier 0 rf |
---|
4542 | 7 fz |
---|
4543 | 2 F /|______Courier fnt |
---|
4544 | -0.19900 0.(name:)ashow |
---|
4545 | 2 fs |
---|
4546 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4547 | 2 F /|______Courier-Oblique fnt |
---|
4548 | -0.22111 0.(short name)ashow |
---|
4549 | 251 234 gm |
---|
4550 | 0 fs |
---|
4551 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4552 | 10 fz |
---|
4553 | 2 F /|______Times-Roman fnt |
---|
4554 | -0.09985 0.(If short name matches a currently loaded sequence,)ashow |
---|
4555 | 262 234 gm |
---|
4556 | 0.16754 0. 32 0.01675 0.(then impose this color mask on that sequence. If this)awidthshow |
---|
4557 | 273 234 gm |
---|
4558 | 0.04577 0. 32 0.00457 0.(line is omitted, then color all sequences this color, and the color)awidthshow |
---|
4559 | 284 234 gm |
---|
4560 | 0.10223 0. 32 0.01022 0.(mask is expected to start at the leftmost column on the screen.)awidthshow |
---|
4561 | 306 90 gm |
---|
4562 | {}mark T /Courier /|______Courier 0 rf |
---|
4563 | 7 fz |
---|
4564 | 2 F /|______Courier fnt |
---|
4565 | -0.19900 0.(length:)ashow |
---|
4566 | 2 fs |
---|
4567 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4568 | 2 F /|______Courier-Oblique fnt |
---|
4569 | -0.23880 0.(length)ashow |
---|
4570 | 306 234 gm |
---|
4571 | 0 fs |
---|
4572 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4573 | 10 fz |
---|
4574 | 2 F /|______Times-Roman fnt |
---|
4575 | 0.40191 0. 32 0.04019 0.(The following list in length long)awidthshow |
---|
4576 | 328 90 gm |
---|
4577 | {}mark T /Courier /|______Courier 0 rf |
---|
4578 | 7 fz |
---|
4579 | 2 F /|______Courier fnt |
---|
4580 | -0.23217 0.(nodash:)ashow |
---|
4581 | 328 234 gm |
---|
4582 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4583 | 10 fz |
---|
4584 | 2 F /|______Times-Roman fnt |
---|
4585 | 0.00579 0. 32 0.00057 0.(Skip over dash characters when imposing this color mask)awidthshow |
---|
4586 | 339 234 gm |
---|
4587 | -0.03414 0.(on the named sequence. This allows an unaligned color)ashow |
---|
4588 | 350 234 gm |
---|
4589 | -0.09637 0.(mask to be placed over aligned sequence.)ashow |
---|
4590 | 372 90 gm |
---|
4591 | {}mark T /Courier /|______Courier 0 rf |
---|
4592 | 7 fz |
---|
4593 | 2 F /|______Courier fnt |
---|
4594 | -0.23880 0.(start:)ashow |
---|
4595 | 372 234 gm |
---|
4596 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4597 | 10 fz |
---|
4598 | 2 F /|______Times-Roman fnt |
---|
4599 | 0.02685 0. 32 0.00268 0.(Begin reading the color mask on the next line.)awidthshow |
---|
4600 | 394 90 gm |
---|
4601 | 0.04302 0. 32 0.00430 0.(Here is a sample color mask file:)awidthshow |
---|
4602 | 413 90 gm |
---|
4603 | {}mark T /Courier /|______Courier 0 rf |
---|
4604 | 7 fz |
---|
4605 | 2 F /|______Courier fnt |
---|
4606 | -0.21070 0.(name:test_sequence)ashow |
---|
4607 | 421 90 gm |
---|
4608 | -0.22387 0.(length:10)ashow |
---|
4609 | 429 90 gm |
---|
4610 | -0.23217 0.(nodash:)ashow |
---|
4611 | 437 90 gm |
---|
4612 | -0.23880 0.(start:)ashow |
---|
4613 | 445 90 gm |
---|
4614 | (3)show |
---|
4615 | 453 90 gm |
---|
4616 | (3)show |
---|
4617 | 461 90 gm |
---|
4618 | (3)show |
---|
4619 | 469 90 gm |
---|
4620 | (6)show |
---|
4621 | 477 90 gm |
---|
4622 | (5)show |
---|
4623 | 485 90 gm |
---|
4624 | (3)show |
---|
4625 | 493 90 gm |
---|
4626 | (3)show |
---|
4627 | 501 90 gm |
---|
4628 | (3)show |
---|
4629 | 509 90 gm |
---|
4630 | (2)show |
---|
4631 | 517 90 gm |
---|
4632 | (7)show |
---|
4633 | 536 90 gm |
---|
4634 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4635 | 10 fz |
---|
4636 | 2 F /|______Times-Roman fnt |
---|
4637 | -0.00993 0.(The colors in the default color lookup table are:)ashow |
---|
4638 | 547 90 gm |
---|
4639 | (0)show |
---|
4640 | 547 126 gm |
---|
4641 | -0.10839 0.(White)ashow |
---|
4642 | 547 270 gm |
---|
4643 | (8)show |
---|
4644 | 547 306 gm |
---|
4645 | -0.33126 0.(Black)ashow |
---|
4646 | 558 90 gm |
---|
4647 | (1)show |
---|
4648 | 558 126 gm |
---|
4649 | -0.08668 0.(Yellow)ashow |
---|
4650 | 558 270 gm |
---|
4651 | (9)show |
---|
4652 | 558 306 gm |
---|
4653 | -0.09704 0.(Grey 1)ashow |
---|
4654 | 569 90 gm |
---|
4655 | (2)show |
---|
4656 | 569 126 gm |
---|
4657 | (Violet)show |
---|
4658 | 569 270 gm |
---|
4659 | (10)show |
---|
4660 | 569 306 gm |
---|
4661 | -0.09704 0.(Grey 2)ashow |
---|
4662 | 580 90 gm |
---|
4663 | (3)show |
---|
4664 | 580 126 gm |
---|
4665 | -0.55415 0.(Red)ashow |
---|
4666 | 580 270 gm |
---|
4667 | (11)show |
---|
4668 | 580 306 gm |
---|
4669 | -0.09704 0.(Grey 3)ashow |
---|
4670 | 591 90 gm |
---|
4671 | (4)show |
---|
4672 | 591 126 gm |
---|
4673 | -0.55255 0.(Aqua)ashow |
---|
4674 | 591 270 gm |
---|
4675 | (12)show |
---|
4676 | 591 306 gm |
---|
4677 | -0.09704 0.(Grey 4)ashow |
---|
4678 | 602 90 gm |
---|
4679 | (5)show |
---|
4680 | 602 126 gm |
---|
4681 | -0.11416 0.(Lime Green)ashow |
---|
4682 | 602 270 gm |
---|
4683 | (13)show |
---|
4684 | 602 306 gm |
---|
4685 | -0.09704 0.(Grey 5)ashow |
---|
4686 | 613 90 gm |
---|
4687 | (6)show |
---|
4688 | 613 126 gm |
---|
4689 | -0.29557 0.(Blue)ashow |
---|
4690 | 613 270 gm |
---|
4691 | (14)show |
---|
4692 | 613 306 gm |
---|
4693 | -0.09704 0.(Grey 6)ashow |
---|
4694 | 624 90 gm |
---|
4695 | (7)show |
---|
4696 | 624 126 gm |
---|
4697 | -0.02070 0.(Purple)ashow |
---|
4698 | 624 270 gm |
---|
4699 | (15)show |
---|
4700 | 624 306 gm |
---|
4701 | -0.10839 0.(White)ashow |
---|
4702 | F T cp |
---|
4703 | %%Page: ? 17 |
---|
4704 | op |
---|
4705 | 31 30 xl |
---|
4706 | 1 1 pen |
---|
4707 | 753 90 gm |
---|
4708 | (nc 31 30 761 582 6 rc)kp |
---|
4709 | 1 setTxMode |
---|
4710 | 0 fs |
---|
4711 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4712 | 7 fz |
---|
4713 | 2 F /|______Times-Roman fnt |
---|
4714 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
4715 | 753 300 gm |
---|
4716 | 12 fz |
---|
4717 | 2 F /|______Times-Roman fnt |
---|
4718 | (17)show |
---|
4719 | 84 90 gm |
---|
4720 | 14 fz |
---|
4721 | 2 F /|______Times-Roman fnt |
---|
4722 | 0.21636 0. 32 0.02163 0.(Appendix B, Adding Functions)awidthshow |
---|
4723 | 107 90 gm |
---|
4724 | 10 fz |
---|
4725 | 2 F /|______Times-Roman fnt |
---|
4726 | -0.04040 0.(The GDE uses a menu description language to define what external programs it can call, and what parameters)ashow |
---|
4727 | 118 90 gm |
---|
4728 | 0.08483 0. 32 0.00848 0.(and data to pass to each function. This language allows users to customize their own environment to suite)awidthshow |
---|
4729 | 129 90 gm |
---|
4730 | -0.14483 0.(individual needs.)ashow |
---|
4731 | 151 90 gm |
---|
4732 | -0.02262 0.(The following is how the GDE handles external programs when selected from a menu:)ashow |
---|
4733 | 0 0 gm |
---|
4734 | (nc 164 126 255 369 6 rc)kp |
---|
4735 | 64 gr |
---|
4736 | 164 211 201 277 14.5 14.5 4 rr |
---|
4737 | 0 gr |
---|
4738 | 164.5 211.5 200.5 276.5 14.5 14.5 0 rr |
---|
4739 | 64 gr |
---|
4740 | 164 126 201 192 14.5 14.5 4 rr |
---|
4741 | 0 gr |
---|
4742 | 164.5 126.5 200.5 191.5 14.5 14.5 0 rr |
---|
4743 | 64 gr |
---|
4744 | 164 299 201 365 14.5 14.5 4 rr |
---|
4745 | 0 gr |
---|
4746 | 164.5 299.5 200.5 364.5 14.5 14.5 0 rr |
---|
4747 | 182 192 gm |
---|
4748 | (nc 164 126 255 208 6 rc)kp |
---|
4749 | 182 210 lin |
---|
4750 | (nc 164 126 255 369 6 rc)kp |
---|
4751 | 176 204 189 218 165 195 4 ar |
---|
4752 | 182 277 gm |
---|
4753 | (nc 164 126 255 296 6 rc)kp |
---|
4754 | 182 299 lin |
---|
4755 | (nc 164 126 255 369 6 rc)kp |
---|
4756 | 176 293 189 306 165 195 4 ar |
---|
4757 | 145 385 91 243 th |
---|
4758 | 158 123 gm |
---|
4759 | 1 setTxMode |
---|
4760 | 12 fz |
---|
4761 | 2 F /|______Times-Roman fnt |
---|
4762 | -0.17835 0.(Display dialog)ashow |
---|
4763 | 165 123 gm |
---|
4764 | -0.07539 0.(box presenting)ashow |
---|
4765 | 172 123 gm |
---|
4766 | 0.30838 0. 32 0.03083 0.(user options.)awidthshow |
---|
4767 | 177 214 gm |
---|
4768 | -0.19335 0.(Write out selected)ashow |
---|
4769 | 184 214 gm |
---|
4770 | -0.13066 0.(data \(if any\) to)ashow |
---|
4771 | 191 214 gm |
---|
4772 | -0.06405 0.(temporary files.)ashow |
---|
4773 | 177 303 gm |
---|
4774 | -0.20286 0.(Call external )ashow |
---|
4775 | 184 303 gm |
---|
4776 | (function, passing)show |
---|
4777 | 191 303 gm |
---|
4778 | -0.10202 0.(parameters and data.)ashow |
---|
4779 | tu |
---|
4780 | 182 299 gm |
---|
4781 | 64 gr |
---|
4782 | 214 299 255 365 4 rc |
---|
4783 | 0 gr |
---|
4784 | 214.5 299.5 254.5 364.5 0 rc |
---|
4785 | 201 331 gm |
---|
4786 | (nc 164 126 211 369 6 rc)kp |
---|
4787 | 213 331 lin |
---|
4788 | (nc 164 126 255 369 6 rc)kp |
---|
4789 | 207 324 221 338 255 285 4 ar |
---|
4790 | ts |
---|
4791 | 223 306 gm |
---|
4792 | 1 setTxMode |
---|
4793 | -0.15270 0.(External program)ashow |
---|
4794 | 230 306 gm |
---|
4795 | 0.09719 0. 32 0.00971 0.(runs analysis, and)awidthshow |
---|
4796 | 237 306 gm |
---|
4797 | -0.06079 0.(writes results to)ashow |
---|
4798 | 244 306 gm |
---|
4799 | -0.06405 0.(temporary files.)ashow |
---|
4800 | tu |
---|
4801 | 213 331 gm |
---|
4802 | 64 gr |
---|
4803 | 217 211 255 277 14.5 14.5 4 rr |
---|
4804 | 0 gr |
---|
4805 | 217.5 211.5 254.5 276.5 14.5 14.5 0 rr |
---|
4806 | 236 299 gm |
---|
4807 | (nc 164 280 255 369 6 rc)kp |
---|
4808 | 236 277 lin |
---|
4809 | (nc 164 126 255 369 6 rc)kp |
---|
4810 | 229 271 243 284 345 375 4 ar |
---|
4811 | ts |
---|
4812 | 227 218 gm |
---|
4813 | 1 setTxMode |
---|
4814 | -0.08067 0.(GDE reads results)ashow |
---|
4815 | 234 218 gm |
---|
4816 | -0.11495 0.(of temporary files)ashow |
---|
4817 | 241 218 gm |
---|
4818 | 0.20019 0. 32 0.02001 0.(\(if any\).)awidthshow |
---|
4819 | tu |
---|
4820 | 236 277 gm |
---|
4821 | 64 gr |
---|
4822 | 217 126 255 192 14.5 14.5 4 rr |
---|
4823 | 0 gr |
---|
4824 | 217.5 126.5 254.5 191.5 14.5 14.5 0 rr |
---|
4825 | 236 211 gm |
---|
4826 | (nc 164 195 255 369 6 rc)kp |
---|
4827 | 236 193 lin |
---|
4828 | (nc 164 126 255 369 6 rc)kp |
---|
4829 | 229 185 243 199 345 375 4 ar |
---|
4830 | ts |
---|
4831 | 227 132 gm |
---|
4832 | 1 setTxMode |
---|
4833 | -0.13632 0.(GDE cleans up)ashow |
---|
4834 | 234 132 gm |
---|
4835 | -0.06405 0.(temporary files,)ashow |
---|
4836 | 241 132 gm |
---|
4837 | -0.04287 0.(and displays new)ashow |
---|
4838 | 248 132 gm |
---|
4839 | (data.)show |
---|
4840 | tu |
---|
4841 | 275 90 gm |
---|
4842 | (nc 31 30 761 582 6 rc)kp |
---|
4843 | 10 fz |
---|
4844 | 2 F /|______Times-Roman fnt |
---|
4845 | -0.00254 0.(Each step in this process is described in a file .GDEmenus in the user's current or home directory.)ashow |
---|
4846 | 297 90 gm |
---|
4847 | -0.02418 0.(The language used in this file describes three phases to an external function call. The first phase describes)ashow |
---|
4848 | 308 90 gm |
---|
4849 | 0.12283 0. 32 0.01228 0.(the menu item as it will appear, and the Unix command line that is actually run when it is selected. The)awidthshow |
---|
4850 | 319 90 gm |
---|
4851 | -0.06280 0.(second phase describes how to prompt for the parameters needed by the function. The third phase describes)ashow |
---|
4852 | 330 90 gm |
---|
4853 | -0.05538 0.(what data needs to be passed as input to the external function, and what data \(if any\) needs to be read back)ashow |
---|
4854 | 341 90 gm |
---|
4855 | 0.58975 0. 32 0.05897 0.(from its output.)awidthshow |
---|
4856 | 363 90 gm |
---|
4857 | -0.01350 0.(The form of the language is a simple keyword/value list delimited by the colon \(:\) character. The language)ashow |
---|
4858 | 374 90 gm |
---|
4859 | 0.13610 0. 32 0.01361 0.(retains old values until new ones are set. For example, setting the menu name is done once for all items in)awidthshow |
---|
4860 | 385 90 gm |
---|
4861 | 0.02822 0. 32 0.00282 0.(that menu, and is only reset when the next menu is reached.)awidthshow |
---|
4862 | 407 90 gm |
---|
4863 | -0.09211 0.(The keywords for phase one are:)ashow |
---|
4864 | 429 90 gm |
---|
4865 | {}mark T /Courier /|______Courier 0 rf |
---|
4866 | 7 fz |
---|
4867 | 2 F /|______Courier fnt |
---|
4868 | -0.19900 0.(menu:)ashow |
---|
4869 | 2 fs |
---|
4870 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4871 | 2 F /|______Courier-Oblique fnt |
---|
4872 | -0.22387 0.(menu name)ashow |
---|
4873 | 429 306 gm |
---|
4874 | 0 fs |
---|
4875 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4876 | 10 fz |
---|
4877 | 2 F /|______Times-Roman fnt |
---|
4878 | -0.06471 0.(Name of current menu)ashow |
---|
4879 | 440 90 gm |
---|
4880 | {}mark T /Courier /|______Courier 0 rf |
---|
4881 | 7 fz |
---|
4882 | 2 F /|______Courier fnt |
---|
4883 | -0.19900 0.(item:)ashow |
---|
4884 | 2 fs |
---|
4885 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4886 | 2 F /|______Courier-Oblique fnt |
---|
4887 | -0.22387 0.(item name)ashow |
---|
4888 | 440 306 gm |
---|
4889 | 0 fs |
---|
4890 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4891 | 10 fz |
---|
4892 | 2 F /|______Times-Roman fnt |
---|
4893 | -0.02093 0.(Name of current menu item)ashow |
---|
4894 | 451 90 gm |
---|
4895 | {}mark T /Courier /|______Courier 0 rf |
---|
4896 | 7 fz |
---|
4897 | 2 F /|______Courier fnt |
---|
4898 | -0.19900 0.(itemmeta:)ashow |
---|
4899 | 2 fs |
---|
4900 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4901 | 2 F /|______Courier-Oblique fnt |
---|
4902 | -0.22743 0.(meta_key)ashow |
---|
4903 | 451 306 gm |
---|
4904 | 0 fs |
---|
4905 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4906 | 10 fz |
---|
4907 | 2 F /|______Times-Roman fnt |
---|
4908 | -0.12283 0.(Meta key equivalence \(quick keys\))ashow |
---|
4909 | 462 90 gm |
---|
4910 | {}mark T /Courier /|______Courier 0 rf |
---|
4911 | 7 fz |
---|
4912 | 2 F /|______Courier fnt |
---|
4913 | -0.19900 0.(itemhelp:)ashow |
---|
4914 | 2 fs |
---|
4915 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4916 | 2 F /|______Courier-Oblique fnt |
---|
4917 | -0.22387 0.(help_file)ashow |
---|
4918 | 462 306 gm |
---|
4919 | 0 fs |
---|
4920 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4921 | 10 fz |
---|
4922 | 2 F /|______Times-Roman fnt |
---|
4923 | 0.15548 0. 32 0.01554 0.(Help file \(either full path, or in)awidthshow |
---|
4924 | 473 306 gm |
---|
4925 | -0.09056 0.(GDE_HELP_DIR\))ashow |
---|
4926 | 481 90 gm |
---|
4927 | {}mark T /Courier /|______Courier 0 rf |
---|
4928 | 7 fz |
---|
4929 | 2 F /|______Courier fnt |
---|
4930 | -0.19900 0.(itemmethod:)ashow |
---|
4931 | 2 fs |
---|
4932 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4933 | 2 F /|______Courier-Oblique fnt |
---|
4934 | -0.21710 0.(Unix command)ashow |
---|
4935 | 503 90 gm |
---|
4936 | 0 fs |
---|
4937 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4938 | 10 fz |
---|
4939 | 2 F /|______Times-Roman fnt |
---|
4940 | 0.14251 0. 32 0.01425 0.(The item method command is a bit more involved, it is the Unix command that will actually run the)awidthshow |
---|
4941 | 514 90 gm |
---|
4942 | 0.02655 0. 32 0.00265 0.(external program intended. It is one line long, and can be up to 256 characters in length. It can have)awidthshow |
---|
4943 | 525 90 gm |
---|
4944 | -0.02996 0.(embedded variable names \(starting with a '$'\) that will be replaced with appropriate values later on. It can)ashow |
---|
4945 | 536 90 gm |
---|
4946 | -0.00277 0.(consist of multiple Unix commands separated by semi-colons \(;\), and may contain shell scripts and)ashow |
---|
4947 | 547 90 gm |
---|
4948 | 0.00350 0. 32 0.00035 0.(background processes as well as simple command names. Examples will be given later.)awidthshow |
---|
4949 | 569 90 gm |
---|
4950 | -0.07740 0.(The keywords for phase two are:)ashow |
---|
4951 | 591 90 gm |
---|
4952 | {}mark T /Courier /|______Courier 0 rf |
---|
4953 | 7 fz |
---|
4954 | 2 F /|______Courier fnt |
---|
4955 | -0.19900 0.(arg:)ashow |
---|
4956 | 2 fs |
---|
4957 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4958 | 2 F /|______Courier-Oblique fnt |
---|
4959 | -0.20848 0.(argument_variable_name)ashow |
---|
4960 | 591 342 gm |
---|
4961 | 0 fs |
---|
4962 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4963 | 10 fz |
---|
4964 | 2 F /|______Times-Roman fnt |
---|
4965 | 0.07934 0. 32 0.00793 0.(Name of this variable. It will appear)awidthshow |
---|
4966 | 602 342 gm |
---|
4967 | 0.09628 0. 32 0.00962 0.(in the itemmethod: line with a dollar)awidthshow |
---|
4968 | 613 342 gm |
---|
4969 | 0.35354 0. 32 0.03535 0.(sign \($\) in front of it.)awidthshow |
---|
4970 | 624 90 gm |
---|
4971 | {}mark T /Courier /|______Courier 0 rf |
---|
4972 | 7 fz |
---|
4973 | 2 F /|______Courier fnt |
---|
4974 | -0.19900 0.(argtype:)ashow |
---|
4975 | 2 fs |
---|
4976 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4977 | 2 F /|______Courier-Oblique fnt |
---|
4978 | -0.20503 0.(slider,chooser,choice_menu or text)ashow |
---|
4979 | 624 342 gm |
---|
4980 | 0 fs |
---|
4981 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4982 | 10 fz |
---|
4983 | 2 F /|______Times-Roman fnt |
---|
4984 | -0.02027 0.(The type of graphic object)ashow |
---|
4985 | 635 342 gm |
---|
4986 | -0.00474 0.(representing this argument.)ashow |
---|
4987 | 657 90 gm |
---|
4988 | {}mark T /Courier /|______Courier 0 rf |
---|
4989 | 7 fz |
---|
4990 | 2 F /|______Courier fnt |
---|
4991 | -0.19900 0.(arglabel:)ashow |
---|
4992 | 2 fs |
---|
4993 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
4994 | 2 F /|______Courier-Oblique fnt |
---|
4995 | -0.21144 0.(descriptive label)ashow |
---|
4996 | 657 342 gm |
---|
4997 | 0 fs |
---|
4998 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
4999 | 10 fz |
---|
5000 | 2 F /|______Times-Roman fnt |
---|
5001 | 0.07995 0. 32 0.00799 0.(A short description of what this)awidthshow |
---|
5002 | 668 342 gm |
---|
5003 | -0.09936 0.(argument represents)ashow |
---|
5004 | 690 90 gm |
---|
5005 | {}mark T /Courier /|______Courier 0 rf |
---|
5006 | 7 fz |
---|
5007 | 2 F /|______Courier fnt |
---|
5008 | -0.19900 0.(argmin:)ashow |
---|
5009 | 2 fs |
---|
5010 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5011 | 2 F /|______Courier-Oblique fnt |
---|
5012 | -0.20805 0.(minimum_value \(integer\))ashow |
---|
5013 | 690 342 gm |
---|
5014 | 0 fs |
---|
5015 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5016 | 10 fz |
---|
5017 | 2 F /|______Times-Roman fnt |
---|
5018 | -0.11270 0.(Used for sliders.)ashow |
---|
5019 | 712 90 gm |
---|
5020 | {}mark T /Courier /|______Courier 0 rf |
---|
5021 | 7 fz |
---|
5022 | 2 F /|______Courier fnt |
---|
5023 | -0.19900 0.(argmax:)ashow |
---|
5024 | 2 fs |
---|
5025 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5026 | 2 F /|______Courier-Oblique fnt |
---|
5027 | -0.20805 0.(maximum_value \(integer\))ashow |
---|
5028 | 712 342 gm |
---|
5029 | 0 fs |
---|
5030 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5031 | 10 fz |
---|
5032 | 2 F /|______Times-Roman fnt |
---|
5033 | -0.11270 0.(Used for sliders.)ashow |
---|
5034 | F T cp |
---|
5035 | %%Page: ? 18 |
---|
5036 | op |
---|
5037 | 31 30 xl |
---|
5038 | 1 1 pen |
---|
5039 | 753 90 gm |
---|
5040 | (nc 31 30 761 582 6 rc)kp |
---|
5041 | 1 setTxMode |
---|
5042 | 0 fs |
---|
5043 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5044 | 7 fz |
---|
5045 | 2 F /|______Times-Roman fnt |
---|
5046 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
5047 | 753 300 gm |
---|
5048 | 12 fz |
---|
5049 | 2 F /|______Times-Roman fnt |
---|
5050 | (18)show |
---|
5051 | 92 90 gm |
---|
5052 | {}mark T /Courier /|______Courier 0 rf |
---|
5053 | 7 fz |
---|
5054 | 2 F /|______Courier fnt |
---|
5055 | -0.19900 0.(argvalue:)ashow |
---|
5056 | 2 fs |
---|
5057 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5058 | 2 F /|______Courier-Oblique fnt |
---|
5059 | -0.20805 0.(default_value \(integer\))ashow |
---|
5060 | 92 342 gm |
---|
5061 | 0 fs |
---|
5062 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5063 | 10 fz |
---|
5064 | 2 F /|______Times-Roman fnt |
---|
5065 | -0.00714 0.(It is the numeric value associated with)ashow |
---|
5066 | 103 342 gm |
---|
5067 | -0.05737 0.(sliders or the default choice in)ashow |
---|
5068 | 114 342 gm |
---|
5069 | -0.03404 0.(choosers, choice_menus, and choice_lists)ashow |
---|
5070 | 125 342 gm |
---|
5071 | 0.10894 0. 32 0.01089 0.(\(the first choice is 0, the second is 1 etc.\))awidthshow |
---|
5072 | 147 90 gm |
---|
5073 | {}mark T /Courier /|______Courier 0 rf |
---|
5074 | 7 fz |
---|
5075 | 2 F /|______Courier fnt |
---|
5076 | -0.19900 0.(argtext:)ashow |
---|
5077 | 2 fs |
---|
5078 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5079 | 2 F /|______Courier-Oblique fnt |
---|
5080 | -0.21559 0.(default value)ashow |
---|
5081 | 147 342 gm |
---|
5082 | 0 fs |
---|
5083 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5084 | 10 fz |
---|
5085 | 2 F /|______Times-Roman fnt |
---|
5086 | -0.07046 0.(Used for text fields.)ashow |
---|
5087 | 169 90 gm |
---|
5088 | {}mark T /Courier /|______Courier 0 rf |
---|
5089 | 7 fz |
---|
5090 | 2 F /|______Courier fnt |
---|
5091 | -0.19900 0.(argchoice:)ashow |
---|
5092 | 2 fs |
---|
5093 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5094 | 2 F /|______Courier-Oblique fnt |
---|
5095 | -0.19900 0.(displayed value)ashow |
---|
5096 | 0 fs |
---|
5097 | 2 F /|______Courier fnt |
---|
5098 | -0.19900 0.(:)ashow |
---|
5099 | 2 fs |
---|
5100 | 2 F /|______Courier-Oblique fnt |
---|
5101 | -0.21710 0.(passed value)ashow |
---|
5102 | 169 342 gm |
---|
5103 | 0 fs |
---|
5104 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5105 | 10 fz |
---|
5106 | 2 F /|______Times-Roman fnt |
---|
5107 | -0.15618 0.(Used for choosers and)ashow |
---|
5108 | 180 342 gm |
---|
5109 | 0.10101 0. 32 0.01010 0.(choice_menus. The first value is)awidthshow |
---|
5110 | 191 342 gm |
---|
5111 | -0.12577 0.(displayed on screen, and the second)ashow |
---|
5112 | 202 342 gm |
---|
5113 | -0.00753 0.(value is passed to the itemmethod)ashow |
---|
5114 | 213 342 gm |
---|
5115 | 0.12620 0.(line.)ashow |
---|
5116 | 235 90 gm |
---|
5117 | -0.06112 0.(The keywords for phase three are as follows:)ashow |
---|
5118 | 257 90 gm |
---|
5119 | {}mark T /Courier /|______Courier 0 rf |
---|
5120 | 7 fz |
---|
5121 | 2 F /|______Courier fnt |
---|
5122 | -0.19900 0.(in:)ashow |
---|
5123 | 2 fs |
---|
5124 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5125 | 2 F /|______Courier-Oblique fnt |
---|
5126 | -0.19900 0.(input_file)ashow |
---|
5127 | 0 fs |
---|
5128 | 2 F /|______Courier fnt |
---|
5129 | ( )show |
---|
5130 | 257 342 gm |
---|
5131 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5132 | 10 fz |
---|
5133 | 2 F /|______Times-Roman fnt |
---|
5134 | 0.07873 0. 32 0.00787 0.(GDE will replace this name with a)awidthshow |
---|
5135 | 268 342 gm |
---|
5136 | -0.12794 0.(randomly generated temporary file)ashow |
---|
5137 | 279 342 gm |
---|
5138 | (name. It will then write the selected)show |
---|
5139 | 290 342 gm |
---|
5140 | 0.24902 0. 32 0.02490 0.(data out to this file.)awidthshow |
---|
5141 | 312 90 gm |
---|
5142 | {}mark T /Courier /|______Courier 0 rf |
---|
5143 | 7 fz |
---|
5144 | 2 F /|______Courier fnt |
---|
5145 | -0.19900 0.(informat:)ashow |
---|
5146 | 2 fs |
---|
5147 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5148 | 2 F /|______Courier-Oblique fnt |
---|
5149 | -0.21890 0.(file_format)ashow |
---|
5150 | 312 342 gm |
---|
5151 | 0 fs |
---|
5152 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5153 | 10 fz |
---|
5154 | 2 F /|______Times-Roman fnt |
---|
5155 | 0.14724 0. 32 0.01472 0.(Write data to this file for input to)awidthshow |
---|
5156 | 323 342 gm |
---|
5157 | 0.33538 0. 32 0.03353 0.(this function. Currently support)awidthshow |
---|
5158 | 334 342 gm |
---|
5159 | -0.05738 0.(values are Genbank, and flat.)ashow |
---|
5160 | 345 90 gm |
---|
5161 | {}mark T /Courier /|______Courier 0 rf |
---|
5162 | 7 fz |
---|
5163 | 2 F /|______Courier fnt |
---|
5164 | -0.23217 0.(inmask:)ashow |
---|
5165 | 345 342 gm |
---|
5166 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5167 | 10 fz |
---|
5168 | 2 F /|______Times-Roman fnt |
---|
5169 | -0.05563 0.(This data can be controlled by a)ashow |
---|
5170 | 356 342 gm |
---|
5171 | 0.14770 0. 32 0.01477 0.(selection mask.)awidthshow |
---|
5172 | 378 90 gm |
---|
5173 | {}mark T /Courier /|______Courier 0 rf |
---|
5174 | 7 fz |
---|
5175 | 2 F /|______Courier fnt |
---|
5176 | -0.23217 0.(insave:)ashow |
---|
5177 | 378 342 gm |
---|
5178 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5179 | 10 fz |
---|
5180 | 2 F /|______Times-Roman fnt |
---|
5181 | 0.08697 0. 32 0.00869 0.(Do not remove this file after running)awidthshow |
---|
5182 | 389 342 gm |
---|
5183 | 0.19424 0. 32 0.01942 0.(the external function. This is useful)awidthshow |
---|
5184 | 400 342 gm |
---|
5185 | 0.01831 0. 32 0.00183 0.(for functions put in the background.)awidthshow |
---|
5186 | 422 90 gm |
---|
5187 | {}mark T /Courier /|______Courier 0 rf |
---|
5188 | 7 fz |
---|
5189 | 2 F /|______Courier fnt |
---|
5190 | -0.19900 0.(out:)ashow |
---|
5191 | 2 fs |
---|
5192 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5193 | 2 F /|______Courier-Oblique fnt |
---|
5194 | -0.21890 0.(output_file)ashow |
---|
5195 | 422 342 gm |
---|
5196 | 0 fs |
---|
5197 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5198 | 10 fz |
---|
5199 | 2 F /|______Times-Roman fnt |
---|
5200 | 0.07873 0. 32 0.00787 0.(GDE will replace this name with a)awidthshow |
---|
5201 | 433 342 gm |
---|
5202 | -0.12794 0.(randomly generated temporary file)ashow |
---|
5203 | 444 342 gm |
---|
5204 | 0.21469 0. 32 0.02146 0.(name. It is up to the external function)awidthshow |
---|
5205 | 455 342 gm |
---|
5206 | 0.36849 0. 32 0.03684 0.(to fill this file with any results that)awidthshow |
---|
5207 | 466 342 gm |
---|
5208 | 0.03570 0. 32 0.00357 0.(might be read back into the GDE.)awidthshow |
---|
5209 | 488 90 gm |
---|
5210 | {}mark T /Courier /|______Courier 0 rf |
---|
5211 | 7 fz |
---|
5212 | 2 F /|______Courier fnt |
---|
5213 | -0.19900 0.(outformat:)ashow |
---|
5214 | 2 fs |
---|
5215 | {}mark T /Courier-Oblique /|______Courier-Oblique 0 rf |
---|
5216 | 2 F /|______Courier-Oblique fnt |
---|
5217 | -0.21890 0.(file_format)ashow |
---|
5218 | 488 342 gm |
---|
5219 | 0 fs |
---|
5220 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5221 | 10 fz |
---|
5222 | 2 F /|______Times-Roman fnt |
---|
5223 | 0.18402 0. 32 0.01840 0.(The data in the output file will be in)awidthshow |
---|
5224 | 499 342 gm |
---|
5225 | 0.29846 0. 32 0.02984 0.(this format. Currently support)awidthshow |
---|
5226 | 510 342 gm |
---|
5227 | -0.05863 0.(values are colormask, Genbank, and)ashow |
---|
5228 | 521 342 gm |
---|
5229 | 0.04431 0.(flat.)ashow |
---|
5230 | 543 90 gm |
---|
5231 | {}mark T /Courier /|______Courier 0 rf |
---|
5232 | 7 fz |
---|
5233 | 2 F /|______Courier fnt |
---|
5234 | -0.22743 0.(outsave:)ashow |
---|
5235 | 543 342 gm |
---|
5236 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5237 | 10 fz |
---|
5238 | 2 F /|______Times-Roman fnt |
---|
5239 | -0.01464 0.(Do not remove this file after reading.)ashow |
---|
5240 | 554 342 gm |
---|
5241 | 0.03158 0. 32 0.00315 0.(This is useful for background tasks.)awidthshow |
---|
5242 | 576 90 gm |
---|
5243 | {}mark T /Courier /|______Courier 0 rf |
---|
5244 | 7 fz |
---|
5245 | 2 F /|______Courier fnt |
---|
5246 | -0.21559 0.(outoverwrite:)ashow |
---|
5247 | 576 342 gm |
---|
5248 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5249 | 10 fz |
---|
5250 | 2 F /|______Times-Roman fnt |
---|
5251 | -0.06021 0.(Overwrite existing sequences in the current)ashow |
---|
5252 | 587 342 gm |
---|
5253 | -0.00816 0.(GDE window. Currently supported with)ashow |
---|
5254 | 598 342 gm |
---|
5255 | -0.03097 0.("gde" format only.)ashow |
---|
5256 | 642 90 gm |
---|
5257 | 0.11749 0. 32 0.01174 0.(Here is a sample dialog box, and it's entry in the .GDEmenus file:)awidthshow |
---|
5258 | F T cp |
---|
5259 | %%Page: ? 19 |
---|
5260 | op |
---|
5261 | 31 30 xl |
---|
5262 | 1 1 pen |
---|
5263 | 753 90 gm |
---|
5264 | (nc 31 30 761 582 6 rc)kp |
---|
5265 | 1 setTxMode |
---|
5266 | 0 fs |
---|
5267 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5268 | 7 fz |
---|
5269 | 2 F /|______Times-Roman fnt |
---|
5270 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
5271 | 753 300 gm |
---|
5272 | 12 fz |
---|
5273 | 2 F /|______Times-Roman fnt |
---|
5274 | (19)show |
---|
5275 | 454 408 241 216 th |
---|
5276 | 147 170 gm |
---|
5277 | tu |
---|
5278 | (nc 143 169 312 326 6 rc)kp |
---|
5279 | ts |
---|
5280 | {}mark T /Courier /|______Courier 0 rf |
---|
5281 | 8.33332 fz |
---|
5282 | 2 F /|______Courier fnt |
---|
5283 | ( )show |
---|
5284 | 162 170 gm |
---|
5285 | (menu:Test function)show |
---|
5286 | 172 170 gm |
---|
5287 | (item:All capitals)show |
---|
5288 | 177 170 gm |
---|
5289 | (itemmethod:\(tr '[a-z]' '[A-Z]' < INPUT_FILE > )show |
---|
5290 | 182 170 gm |
---|
5291 | (INPUT_FILE.tmp ; mv INPUT_FILE.tmp $SAVE_FILE_NAME ; gde )show |
---|
5292 | 187 170 gm |
---|
5293 | ($SAVE_FILE_NAME -Wx $SIZE ; rm INPUT_FILE\) &)show |
---|
5294 | 197 170 gm |
---|
5295 | (arg:SAVE_FILE_NAME)show |
---|
5296 | 202 170 gm |
---|
5297 | (argtype:text)show |
---|
5298 | 207 170 gm |
---|
5299 | (arglabel:Save converted data as?)show |
---|
5300 | 212 170 gm |
---|
5301 | (argtext:CAPS)show |
---|
5302 | 222 170 gm |
---|
5303 | (arg:SIZE)show |
---|
5304 | 227 170 gm |
---|
5305 | (arglabel:Text size?)show |
---|
5306 | 232 170 gm |
---|
5307 | (argtype:chooser)show |
---|
5308 | 237 170 gm |
---|
5309 | (argvalue:1)show |
---|
5310 | 242 170 gm |
---|
5311 | (argchoice:Small:small)show |
---|
5312 | 247 170 gm |
---|
5313 | (argchoice:Medium:medium)show |
---|
5314 | 252 170 gm |
---|
5315 | (argchoice:Large:large)show |
---|
5316 | 257 170 gm |
---|
5317 | (argchoice:Extra Large:extra_large)show |
---|
5318 | 267 170 gm |
---|
5319 | (in:INPUT_FILE)show |
---|
5320 | 272 170 gm |
---|
5321 | (informat:flat)show |
---|
5322 | 277 170 gm |
---|
5323 | (insave:)show |
---|
5324 | tu |
---|
5325 | 0 0 gm |
---|
5326 | (nc 72 162 313 378 6 rc)kp |
---|
5327 | 64 gr |
---|
5328 | 73 166 141 355 1 rc |
---|
5329 | 0 gr |
---|
5330 | 73.5 166.5 140.5 354.5 0 rc |
---|
5331 | 64 gr |
---|
5332 | 78 174 88 192 11.5 11.5 1 rr |
---|
5333 | 0 gr |
---|
5334 | 78.5 174.5 87.5 191.5 11.5 11.5 0 rr |
---|
5335 | 64 gr |
---|
5336 | 77 171 137 352 1 rc |
---|
5337 | T 181 31.07141 171 77 44 341 58 T 1 db |
---|
5338 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5339 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5340 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5341 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5342 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5343 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5344 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5345 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5346 | 0000000008000000000000004080000000000000000000000000000000000000000000000000000000000000 |
---|
5347 | 0000F04204000007800000004040000000000000000000000000000000000000000000000000000000000000 |
---|
5348 | 0001084404000008400000004040000000000000000000000000000000000000000000000000000000000000 |
---|
5349 | 0002044802000010070B07384020000000000000000000000000000000000000000000000000000000000000 |
---|
5350 | 0002045002000010088C88444020000000000000000000000000000000000000000000000000000000000000 |
---|
5351 | 0002047002000010008890444020000000000000000000000000000000000000000000000000000000000000 |
---|
5352 | 00020448020000100788907C4020000000000000000000000000000000000000000000000000000000000000 |
---|
5353 | 0002044402000010088890404020000000000000000000000000000000000000000000000000000000000000 |
---|
5354 | 0001084202000008488888444020000000000000000000000000000000000000000000000000000000000000 |
---|
5355 | 0000F04202000007874887384020000000000000000000000000000000000000000000000000000000000000 |
---|
5356 | 0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000 |
---|
5357 | 0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000 |
---|
5358 | 0000000008000000000000000080000000000000000000000000000000000000000000000000000000000000 |
---|
5359 | 0100000010000800000000000100000000000000000000000000000000000000000000000000000000000000 |
---|
5360 | 00C0000060000600000000000600000000000000000000000000000000000000000000000000000000000000 |
---|
5361 | 003FFFFF800001FFFFFFFFFFF800000000000000000000000000000000000000000000000000000000000000 |
---|
5362 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5363 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5364 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5365 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5366 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5367 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5368 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5369 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5370 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5371 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5372 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5373 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5374 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5375 | 00000000000000000000000000C00C0000000000000000000000000000000000000000000000000000000000 |
---|
5376 | 03C00000000000000000008000C00C0040000000380000000000000000000000000000000000000000000000 |
---|
5377 | 06600000000000000000018000C00C00C00000004C0000000000000000000000000000000000000000000000 |
---|
5378 | 0603C663C03C786C663C6FE787C07C79F3C03C3E0C0000000000000000000000000000000000000000000000 |
---|
5379 | 070666666066CC7666666D8CCCC0CCCCC6606660180000000000000000000000000000000000000000000000 |
---|
5380 | 03C066666060CC666666718CCCC0CC0CC0600670300000000000000000000000000000000000000000000000 |
---|
5381 | 00E3E347E060CC66347E618FCCC0CC7CC3E03E3C300000000000000000000000000000000000000000000000 |
---|
5382 | 006663460060CC663460618C0CC0CCCCC660660E000000000000000000000000000000000000000000000000 |
---|
5383 | 066661862062CC661862618C4DC0DCCCC6606606300000000000000000000000000000000000000000000000 |
---|
5384 | 03C3B183C03C7866183C60E786C06C7673B03B7C300000000000000000000000000000000000000000000000 |
---|
5385 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5386 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5387 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5388 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5389 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5390 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5391 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5392 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5393 | 01E0C1E1E0000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5394 | 0210C11200000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5395 | 0401211200000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5396 | 0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5397 | 04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5398 | 0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5399 | 0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5400 | T 181 30 171 108.05261 44 341 57 T 1 db |
---|
5401 | 0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5402 | 04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5403 | 0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5404 | 0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5405 | 0212110028000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5406 | 01E21103C8000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5407 | 000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5408 | 000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5409 | 000000003E000000000000000000000000000000000000000000000000000000100000000000000000000000 |
---|
5410 | 07FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF00000000000000000000000 |
---|
5411 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5412 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5413 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5414 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5415 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5416 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5417 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5418 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5419 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5420 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5421 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5422 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5423 | 000000000000000000000000000000003FFFFFFFFFFFFFFFF000000000000800000000000000000001000000 |
---|
5424 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5425 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5426 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5427 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5428 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5429 | 0000000000018000000000000000088030000000220000000000000000000800000000000000000001000000 |
---|
5430 | 07F80002000180001C00003C0000088030082000220000000002000000000807C00800004000000001000000 |
---|
5431 | 00C00006000000002600004000000880300C6000200000000002000000000804000800004000000001000000 |
---|
5432 | 00C1E33F81F19F1E0600004059870880300C61C1E2222CC000020E2CF1C00804089EB38041C59E3801000000 |
---|
5433 | 00C33336030183330C00006066488880300AA2222222332000021131122008040888C4404226224401000000 |
---|
5434 | 00C331A6038186331800003844408880300AA222222222200002012112200807850880404024224401000000 |
---|
5435 | 00C3F0C601E18E3F1800000C44478880300923E22222222000020F2113E00804020883C041E4227C01000000 |
---|
5436 | 00C3016600718C30000000044448888030092202222222200002112132000804050884404224264001000000 |
---|
5437 | 00C31336003198311800000444488880300822226226222000021120D22008040888844042241A4401000000 |
---|
5438 | 00C1E33383E19F1E1800007844474880300821C1A21A22200003CEA011C00807C88683A079D4023801000000 |
---|
5439 | 0000000000000000000000000000000030000000000000000000000010000800000000000000020001000000 |
---|
5440 | 00000000000000000000000000000000300000000000000000000000E00008000000000000001C0001000000 |
---|
5441 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5442 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5443 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5444 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5445 | 000000000000000000003FFFFFFFFFFFF00000000000000003FFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFF000000 |
---|
5446 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5447 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5448 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5449 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5450 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5451 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5452 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5453 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5454 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5455 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5456 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5457 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5458 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5459 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5460 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5461 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5462 | 77 171 137 352 1 rc |
---|
5463 | T 181 31.07141 171 77 44 341 58 T 1 db |
---|
5464 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5465 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5466 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5467 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5468 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5469 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5470 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5471 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5472 | 0000000008000000000000004080000000000000000000000000000000000000000000000000000000000000 |
---|
5473 | 0000F04204000007800000004040000000000000000000000000000000000000000000000000000000000000 |
---|
5474 | 0001084404000008400000004040000000000000000000000000000000000000000000000000000000000000 |
---|
5475 | 0002044802000010070B07384020000000000000000000000000000000000000000000000000000000000000 |
---|
5476 | 0002045002000010088C88444020000000000000000000000000000000000000000000000000000000000000 |
---|
5477 | 0002047002000010008890444020000000000000000000000000000000000000000000000000000000000000 |
---|
5478 | 00020448020000100788907C4020000000000000000000000000000000000000000000000000000000000000 |
---|
5479 | 0002044402000010088890404020000000000000000000000000000000000000000000000000000000000000 |
---|
5480 | 0001084202000008488888444020000000000000000000000000000000000000000000000000000000000000 |
---|
5481 | 0000F04202000007874887384020000000000000000000000000000000000000000000000000000000000000 |
---|
5482 | 0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000 |
---|
5483 | 0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000 |
---|
5484 | 0000000008000000000000000080000000000000000000000000000000000000000000000000000000000000 |
---|
5485 | 0100000010000800000000000100000000000000000000000000000000000000000000000000000000000000 |
---|
5486 | 00C0000060000600000000000600000000000000000000000000000000000000000000000000000000000000 |
---|
5487 | 003FFFFF800001FFFFFFFFFFF800000000000000000000000000000000000000000000000000000000000000 |
---|
5488 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5489 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5490 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5491 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5492 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5493 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5494 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5495 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5496 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5497 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5498 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5499 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5500 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5501 | 00000000000000000000000000C00C0000000000000000000000000000000000000000000000000000000000 |
---|
5502 | 03C00000000000000000008000C00C0040000000380000000000000000000000000000000000000000000000 |
---|
5503 | 06600000000000000000018000C00C00C00000004C0000000000000000000000000000000000000000000000 |
---|
5504 | 0603C663C03C786C663C6FE787C07C79F3C03C3E0C0000000000000000000000000000000000000000000000 |
---|
5505 | 070666666066CC7666666D8CCCC0CCCCC6606660180000000000000000000000000000000000000000000000 |
---|
5506 | 03C066666060CC666666718CCCC0CC0CC0600670300000000000000000000000000000000000000000000000 |
---|
5507 | 00E3E347E060CC66347E618FCCC0CC7CC3E03E3C300000000000000000000000000000000000000000000000 |
---|
5508 | 006663460060CC663460618C0CC0CCCCC660660E000000000000000000000000000000000000000000000000 |
---|
5509 | 066661862062CC661862618C4DC0DCCCC6606606300000000000000000000000000000000000000000000000 |
---|
5510 | 03C3B183C03C7866183C60E786C06C7673B03B7C300000000000000000000000000000000000000000000000 |
---|
5511 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5512 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5513 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5514 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5515 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5516 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5517 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5518 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5519 | 01E0C1E1E0000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5520 | 0210C11200000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5521 | 0401211200000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5522 | 0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5523 | 04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5524 | 0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5525 | 0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5526 | T 181 30 171 108.05261 44 341 57 T 1 db |
---|
5527 | 0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5528 | 04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5529 | 0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5530 | 0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5531 | 0212110028000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5532 | 01E21103C8000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5533 | 000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5534 | 000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5535 | 000000003E000000000000000000000000000000000000000000000000000000100000000000000000000000 |
---|
5536 | 07FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF00000000000000000000000 |
---|
5537 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5538 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5539 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5540 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5541 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5542 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5543 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5544 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5545 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5546 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5547 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5548 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5549 | 000000000000000000000000000000003FFFFFFFFFFFFFFFF000000000000800000000000000000001000000 |
---|
5550 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5551 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5552 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5553 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5554 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5555 | 0000000000018000000000000000088030000000220000000000000000000800000000000000000001000000 |
---|
5556 | 07F80002000180001C00003C0000088030082000220000000002000000000807C00800004000000001000000 |
---|
5557 | 00C00006000000002600004000000880300C6000200000000002000000000804000800004000000001000000 |
---|
5558 | 00C1E33F81F19F1E0600004059870880300C61C1E2222CC000020E2CF1C00804089EB38041C59E3801000000 |
---|
5559 | 00C33336030183330C00006066488880300AA2222222332000021131122008040888C4404226224401000000 |
---|
5560 | 00C331A6038186331800003844408880300AA222222222200002012112200807850880404024224401000000 |
---|
5561 | 00C3F0C601E18E3F1800000C44478880300923E22222222000020F2113E00804020883C041E4227C01000000 |
---|
5562 | 00C3016600718C30000000044448888030092202222222200002112132000804050884404224264001000000 |
---|
5563 | 00C31336003198311800000444488880300822226226222000021120D22008040888844042241A4401000000 |
---|
5564 | 00C1E33383E19F1E1800007844474880300821C1A21A22200003CEA011C00807C88683A079D4023801000000 |
---|
5565 | 0000000000000000000000000000000030000000000000000000000010000800000000000000020001000000 |
---|
5566 | 00000000000000000000000000000000300000000000000000000000E00008000000000000001C0001000000 |
---|
5567 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5568 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5569 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5570 | 0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000 |
---|
5571 | 000000000000000000003FFFFFFFFFFFF00000000000000003FFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFF000000 |
---|
5572 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5573 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5574 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5575 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5576 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5577 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5578 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5579 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5580 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5581 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5582 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5583 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5584 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5585 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5586 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5587 | 0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 |
---|
5588 | 118 301 gm |
---|
5589 | 0 gr |
---|
5590 | 118 274 lin |
---|
5591 | 118 239 gm |
---|
5592 | 118 214 lin |
---|
5593 | 130 241 gm |
---|
5594 | 130 275 lin |
---|
5595 | 118 301 gm |
---|
5596 | 118 344 lin |
---|
5597 | 130 214 gm |
---|
5598 | 119 214 lin |
---|
5599 | 78.5 173.5 87.5 192.5 11.5 11.5 0 rr |
---|
5600 | 78.5 196.5 87.5 227.5 11.5 11.5 0 rr |
---|
5601 | 118 275 gm |
---|
5602 | 129 275 lin |
---|
5603 | 129 241 lin |
---|
5604 | 200.5 163.5 223.5 262.5 13.5 13.5 0 rr |
---|
5605 | pr |
---|
5606 | 100 267 pl |
---|
5607 | 98 275 pl |
---|
5608 | 100 275 pl |
---|
5609 | 101 275 pl |
---|
5610 | 100 267 pl |
---|
5611 | 1 ep |
---|
5612 | 100 377 gm |
---|
5613 | 100 275 lin |
---|
5614 | 229.5 163.5 276.5 262.5 13.5 13.5 0 rr |
---|
5615 | 0 0 pen |
---|
5616 | 248 325 gm |
---|
5617 | 248 325 lin |
---|
5618 | nc ct 39 0 put |
---|
5619 | 1 1 pen |
---|
5620 | 248 263 gm |
---|
5621 | bp |
---|
5622 | 248 324 F qi |
---|
5623 | 248 324 qc |
---|
5624 | 248 362 qc |
---|
5625 | 248 362 qc |
---|
5626 | 124 363 qc |
---|
5627 | 124 363 F qq |
---|
5628 | ef |
---|
5629 | 9 ec |
---|
5630 | (nc 72 162 313 378 6 rc)kp |
---|
5631 | pr |
---|
5632 | 124 348 pl |
---|
5633 | 121 356 pl |
---|
5634 | 124 356 pl |
---|
5635 | 125 356 pl |
---|
5636 | 124 348 pl |
---|
5637 | 1 ep |
---|
5638 | 124 357 lin |
---|
5639 | 100 377 gm |
---|
5640 | 214 377 lin |
---|
5641 | 214 263 gm |
---|
5642 | 214 377 lin |
---|
5643 | 322 90 gm |
---|
5644 | (nc 31 30 761 582 6 rc)kp |
---|
5645 | 1 setTxMode |
---|
5646 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5647 | 10 fz |
---|
5648 | 2 F /|______Times-Roman fnt |
---|
5649 | -0.02491 0.(Using the default parameters given in the dialog box, the executed Unix command line would be:)ashow |
---|
5650 | 341 90 gm |
---|
5651 | {}mark T /Courier /|______Courier 0 rf |
---|
5652 | 7 fz |
---|
5653 | 2 F /|______Courier fnt |
---|
5654 | -0.20088 0.(\(tr '[a-z]' '[A-Z]' < .gde_001 >.gde_001.tmp ; mv .gde_001.tmp CAPS ; gde CAPS -Wx medium ; rm .gde_001 \) &)ashow |
---|
5655 | 363 90 gm |
---|
5656 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5657 | 10 fz |
---|
5658 | 2 F /|______Times-Roman fnt |
---|
5659 | -0.06463 0.(where )ashow |
---|
5660 | {}mark T /Courier /|______Courier 0 rf |
---|
5661 | 7 fz |
---|
5662 | 2 F /|______Courier fnt |
---|
5663 | -0.06048 0.(.gde_001)ashow |
---|
5664 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5665 | 10 fz |
---|
5666 | 2 F /|______Times-Roman fnt |
---|
5667 | -0.05946 0.( is the name of the temporary file generated by the GDE which contains the selected sequences)ashow |
---|
5668 | 374 90 gm |
---|
5669 | 0.09124 0. 32 0.00912 0.(in flat file format. Since the GDE runs this command in the background \('&' at the end\) it is necessary to)awidthshow |
---|
5670 | 385 90 gm |
---|
5671 | (specify the )show |
---|
5672 | {}mark T /Courier /|______Courier 0 rf |
---|
5673 | 7 fz |
---|
5674 | 2 F /|______Courier fnt |
---|
5675 | (insave: )show |
---|
5676 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5677 | 10 fz |
---|
5678 | 2 F /|______Times-Roman fnt |
---|
5679 | -0.00428 0.(line, and to remove all temporary files manually. There is no output file specific because)ashow |
---|
5680 | 396 90 gm |
---|
5681 | -0.02909 0.(the data is not loaded back into the current GDE window, but rather a new GDE window is opened on the)ashow |
---|
5682 | 407 90 gm |
---|
5683 | -0.01303 0.(file. A simpler command that reloads the data after conversion might be:)ashow |
---|
5684 | 426 90 gm |
---|
5685 | {}mark T /Courier /|______Courier 0 rf |
---|
5686 | 7 fz |
---|
5687 | 2 F /|______Courier fnt |
---|
5688 | -0.21559 0.(item:All caps)ashow |
---|
5689 | 434 90 gm |
---|
5690 | -0.20352 0.(itemmethod:tr '[a-z]' '[A-Z]' <INPUT > OUTPUT)ashow |
---|
5691 | 450 90 gm |
---|
5692 | -0.22743 0.(in:INPUT)ashow |
---|
5693 | 458 90 gm |
---|
5694 | -0.21559 0.(informat:flat)ashow |
---|
5695 | 474 90 gm |
---|
5696 | -0.22111 0.(out:OUTPUT)ashow |
---|
5697 | 482 90 gm |
---|
5698 | -0.21430 0.(outformat:flat)ashow |
---|
5699 | 501 90 gm |
---|
5700 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5701 | 10 fz |
---|
5702 | 2 F /|______Times-Roman fnt |
---|
5703 | 0.06103 0. 32 0.00610 0.(In this example, no arguments are specified, and so no dialog box will appear. The command is not run in)awidthshow |
---|
5704 | 512 90 gm |
---|
5705 | -0.03242 0.(the background, so the GDE can clean up after itself automatically. The converted sequence is automatically)ashow |
---|
5706 | 523 90 gm |
---|
5707 | -0.07383 0.(loaded back into the current GDE window.)ashow |
---|
5708 | 545 90 gm |
---|
5709 | 0.02014 0. 32 0.00201 0.(In general, the easiest type of program to integrate into the GDE is a program completely driven from a)awidthshow |
---|
5710 | 556 90 gm |
---|
5711 | -0.00051 0.(Unix command line. Interactive programs can be tied in \(MFOLD for example\), however shell scripts must)ashow |
---|
5712 | 567 90 gm |
---|
5713 | -0.01737 0.(be used to drive the parameter entry for these programs. Programs of the form:)ashow |
---|
5714 | 586 90 gm |
---|
5715 | {}mark T /Courier /|______Courier 0 rf |
---|
5716 | 7 fz |
---|
5717 | 2 F /|______Courier fnt |
---|
5718 | -0.20149 0.(program_name -a1 argument1 -a2 arguement2 -f inputfile -er errorfile > outputfile)ashow |
---|
5719 | 608 90 gm |
---|
5720 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5721 | 10 fz |
---|
5722 | 2 F /|______Times-Roman fnt |
---|
5723 | 0.06240 0. 32 0.00624 0.(can be specified in the .GDEmenus file directly. As this is the general form of most one Unix commands,)awidthshow |
---|
5724 | 619 90 gm |
---|
5725 | 0.06774 0. 32 0.00677 0.(these tend to be simpler to implement under the GDE.)awidthshow |
---|
5726 | 641 90 gm |
---|
5727 | 0.07995 0. 32 0.00799 0.(As functions grow in complexity, they may begin to need a user interface of their own. In these cases, the)awidthshow |
---|
5728 | 652 90 gm |
---|
5729 | -0.01388 0.(command line calling arguments are still necessary in order to allow the GDE to hand them the appropriate)ashow |
---|
5730 | 663 90 gm |
---|
5731 | -0.02767 0.(data, and possible retrieve results after some external manipulation.)ashow |
---|
5732 | F T cp |
---|
5733 | %%Page: ? 20 |
---|
5734 | op |
---|
5735 | 31 30 xl |
---|
5736 | 1 1 pen |
---|
5737 | 753 90 gm |
---|
5738 | (nc 31 30 761 582 6 rc)kp |
---|
5739 | 1 setTxMode |
---|
5740 | 0 fs |
---|
5741 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5742 | 7 fz |
---|
5743 | 2 F /|______Times-Roman fnt |
---|
5744 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
5745 | 753 300 gm |
---|
5746 | 12 fz |
---|
5747 | 2 F /|______Times-Roman fnt |
---|
5748 | (20)show |
---|
5749 | 84 90 gm |
---|
5750 | 14 fz |
---|
5751 | 2 F /|______Times-Roman fnt |
---|
5752 | 0.49774 0. 32 0.04977 0.(Appendix C, External functions)awidthshow |
---|
5753 | 107 90 gm |
---|
5754 | 10 fz |
---|
5755 | 2 F /|______Times-Roman fnt |
---|
5756 | 0.08163 0. 32 0.00816 0.(ClustalV - Cluster multiple sequence alignment)awidthshow |
---|
5757 | 129 90 gm |
---|
5758 | 0.30380 0. 32 0.03038 0.(Author: Des Higgins.)awidthshow |
---|
5759 | 151 90 gm |
---|
5760 | -0.25508 0.(Reference:)ashow |
---|
5761 | 151 162 gm |
---|
5762 | 0.14328 0. 32 0.01432 0.(Higgins,D.G. Bleasby,A.J. and Fuchs,R. \(1991\) CLUSTAL V: improved software)awidthshow |
---|
5763 | 162 162 gm |
---|
5764 | 0.13442 0. 32 0.01344 0.(for multiple sequence alignment. ms. submitted to CABIOS)awidthshow |
---|
5765 | 183 90 gm |
---|
5766 | -0.11924 0.(Parameters:)ashow |
---|
5767 | 194 162 gm |
---|
5768 | -0.07839 0.(k-tuple pairwise search)ashow |
---|
5769 | 194 270 gm |
---|
5770 | -0.07196 0.(Word size for pairwise comparisons)ashow |
---|
5771 | 205 162 gm |
---|
5772 | -0.14807 0.(Window size)ashow |
---|
5773 | 205 270 gm |
---|
5774 | 0.07278 0. 32 0.00727 0.(Smaller values give faster alignments,)awidthshow |
---|
5775 | 216 270 gm |
---|
5776 | -0.03422 0.(larger values are more sensitive.)ashow |
---|
5777 | 227 162 gm |
---|
5778 | -0.05999 0.(Transitions weighted)ashow |
---|
5779 | 227 270 gm |
---|
5780 | 0.19729 0. 32 0.01972 0.(Can weight transitions twice as high as)awidthshow |
---|
5781 | 238 270 gm |
---|
5782 | -0.01446 0.(transversions \(DNA only\).)ashow |
---|
5783 | 249 162 gm |
---|
5784 | -0.04051 0.(Fixed gap penalty)ashow |
---|
5785 | 249 270 gm |
---|
5786 | 0.06027 0. 32 0.00602 0.(Gap insertion penalty, lower value, more gaps)awidthshow |
---|
5787 | 260 162 gm |
---|
5788 | 0.20385 0. 32 0.02038 0.(Floating gap penalty)awidthshow |
---|
5789 | 260 270 gm |
---|
5790 | 0.02777 0. 32 0.00277 0.(Gap extension penalty, lower value, longer gaps)awidthshow |
---|
5791 | 304 90 gm |
---|
5792 | 0.11117 0.(Comments:)ashow |
---|
5793 | 315 162 gm |
---|
5794 | -0.01083 0.(ClustalV is a directed multiple sequence alignment algorithm that)ashow |
---|
5795 | 326 162 gm |
---|
5796 | 0.06652 0. 32 0.00665 0.(aligns a set of sequences based on their level of similarity. It first)awidthshow |
---|
5797 | 337 162 gm |
---|
5798 | 0.05584 0. 32 0.00558 0.(uses a Lipman Peasron pairwise similarity scoring to find "clusters")awidthshow |
---|
5799 | 348 162 gm |
---|
5800 | -0.06562 0.(of similar sequences, and pre-aligns those sequences. It then adds)ashow |
---|
5801 | 359 162 gm |
---|
5802 | 0.03463 0. 32 0.00346 0.(other sequences to the alignment in the order of their similarity so as)awidthshow |
---|
5803 | 370 162 gm |
---|
5804 | -0.02696 0.(to produce the cleanest alignment.)ashow |
---|
5805 | 392 162 gm |
---|
5806 | 0.09170 0. 32 0.00917 0.(Warning: ClustalV only uses unambiguous character codes. It will also)awidthshow |
---|
5807 | 403 162 gm |
---|
5808 | 0.04348 0. 32 0.00434 0.(convert all sequences to upper case in the process of aligning. Clustal)awidthshow |
---|
5809 | 414 162 gm |
---|
5810 | 0.04180 0. 32 0.00418 0.(does not pass back comments, author etc. Be sure to keep copies of your)awidthshow |
---|
5811 | 425 162 gm |
---|
5812 | 0.15106 0. 32 0.01510 0.(sequences if you do not wish to lose this information.)awidthshow |
---|
5813 | F T cp |
---|
5814 | %%Page: ? 21 |
---|
5815 | op |
---|
5816 | 31 30 xl |
---|
5817 | 1 1 pen |
---|
5818 | 753 90 gm |
---|
5819 | (nc 31 30 761 582 6 rc)kp |
---|
5820 | 1 setTxMode |
---|
5821 | 0 fs |
---|
5822 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5823 | 7 fz |
---|
5824 | 2 F /|______Times-Roman fnt |
---|
5825 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
5826 | 753 300 gm |
---|
5827 | 12 fz |
---|
5828 | 2 F /|______Times-Roman fnt |
---|
5829 | (21)show |
---|
5830 | 81 90 gm |
---|
5831 | 10 fz |
---|
5832 | 2 F /|______Times-Roman fnt |
---|
5833 | -0.08074 0.(MFOLD - RNA secondary prediction)ashow |
---|
5834 | 103 90 gm |
---|
5835 | -0.03694 0.(Author: Michael Zuker)ashow |
---|
5836 | 125 90 gm |
---|
5837 | -0.17959 0.(Reference: )ashow |
---|
5838 | 125 162 gm |
---|
5839 | 0.13900 0. 32 0.01390 0.(M. Zuker)awidthshow |
---|
5840 | 136 162 gm |
---|
5841 | 0.27359 0. 32 0.02735 0.(On Finding All Suboptimal Foldings of an RNA Molecule.)awidthshow |
---|
5842 | 147 162 gm |
---|
5843 | 0.16525 0. 32 0.01652 0.(Science, 244, 48-52, \(1989\))awidthshow |
---|
5844 | 169 162 gm |
---|
5845 | 0.12847 0. 32 0.01284 0.(J. A. Jaeger, D. H. Turner and M. Zuker)awidthshow |
---|
5846 | 180 162 gm |
---|
5847 | -0.06132 0.(Improved Predictions of Secondary Structures for RNA.)ashow |
---|
5848 | 191 162 gm |
---|
5849 | 0.25482 0. 32 0.02548 0.(Proc. Natl. Acad. Sci. USA, BIOCHEMISTRY, 86, 7706-7710, \(1989\))awidthshow |
---|
5850 | 213 162 gm |
---|
5851 | 0.12847 0. 32 0.01284 0.(J. A. Jaeger, D. H. Turner and M. Zuker)awidthshow |
---|
5852 | 224 162 gm |
---|
5853 | -0.01690 0.(Predicting Optimal and Suboptimal Secondary Structure for RNA.)ashow |
---|
5854 | 235 162 gm |
---|
5855 | 0.13473 0. 32 0.01347 0.(in "Molecular Evolution: Computer Analysis of Protein and)awidthshow |
---|
5856 | 246 162 gm |
---|
5857 | (Nucleic Acid Sequences", R. F. Doolittle ed.)show |
---|
5858 | 257 162 gm |
---|
5859 | 0.18035 0. 32 0.01803 0.(Methods in Enzymology, 183, 281-306 \(1989\))awidthshow |
---|
5860 | 279 90 gm |
---|
5861 | -0.11924 0.(Parameters:)ashow |
---|
5862 | 290 162 gm |
---|
5863 | -0.11352 0.(Linear/circular RNA fold)ashow |
---|
5864 | 301 162 gm |
---|
5865 | 0.25527 0. 32 0.02552 0.(ct File to save results)awidthshow |
---|
5866 | 323 90 gm |
---|
5867 | 0.11117 0.(Comments:)ashow |
---|
5868 | 334 162 gm |
---|
5869 | 0.06652 0. 32 0.00665 0.(MFOLD passes it's output to a program Zuk_to_gen that translates the secondary)awidthshow |
---|
5870 | 345 162 gm |
---|
5871 | -0.01971 0.(structure prediction to a nested bracket \([]\) notation. This notation can then be used)ashow |
---|
5872 | 356 162 gm |
---|
5873 | -0.00996 0.(in the Highlight Helix, and Draw Secondary structure \(LoopTool\) functions.)ashow |
---|
5874 | 378 162 gm |
---|
5875 | -0.01683 0.(MFOLD currently does not support much in the way of additional parameters.)ashow |
---|
5876 | 389 162 gm |
---|
5877 | -0.04089 0.(We hope to have all additional parameters available soon.)ashow |
---|
5878 | F T cp |
---|
5879 | %%Page: ? 22 |
---|
5880 | op |
---|
5881 | 31 30 xl |
---|
5882 | 1 1 pen |
---|
5883 | 753 90 gm |
---|
5884 | (nc 31 30 761 582 6 rc)kp |
---|
5885 | 1 setTxMode |
---|
5886 | 0 fs |
---|
5887 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5888 | 7 fz |
---|
5889 | 2 F /|______Times-Roman fnt |
---|
5890 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
5891 | 753 300 gm |
---|
5892 | 12 fz |
---|
5893 | 2 F /|______Times-Roman fnt |
---|
5894 | (22)show |
---|
5895 | 92 90 gm |
---|
5896 | 10 fz |
---|
5897 | 2 F /|______Times-Roman fnt |
---|
5898 | -0.01799 0.(Blast - Basic Local Alignment Search Tool)ashow |
---|
5899 | 114 90 gm |
---|
5900 | -0.25508 0.(Reference:)ashow |
---|
5901 | 125 162 gm |
---|
5902 | 0.16143 0. 32 0.01614 0.(Karlin, Samuel and Stephen F. Altschul \(1990\). Methods for)awidthshow |
---|
5903 | 136 162 gm |
---|
5904 | -0.04147 0.(assessing the statistical significance of molecular sequence)ashow |
---|
5905 | 147 162 gm |
---|
5906 | -0.01135 0.(features by using general scoring schemes, Proc. Natl. Acad.)ashow |
---|
5907 | 158 162 gm |
---|
5908 | 0.51742 0. 32 0.05174 0.(Sci. USA 87:2264-2268.)awidthshow |
---|
5909 | 180 90 gm |
---|
5910 | 0.46295 0. 32 0.04629 0.( )awidthshow |
---|
5911 | 180 162 gm |
---|
5912 | 0.27801 0. 32 0.02780 0.(Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W.)awidthshow |
---|
5913 | 191 90 gm |
---|
5914 | 0.46295 0. 32 0.04629 0.( )awidthshow |
---|
5915 | 191 162 gm |
---|
5916 | 0.10040 0. 32 0.01004 0.(Myers, and David J. Lipman \(1990\). Basic local alignment)awidthshow |
---|
5917 | 202 90 gm |
---|
5918 | 0.46295 0. 32 0.04629 0.( )awidthshow |
---|
5919 | 202 162 gm |
---|
5920 | 0.45684 0. 32 0.04568 0.(search tool, J. Mol. Biol. 215:403-410.)awidthshow |
---|
5921 | 224 90 gm |
---|
5922 | 0.46875 0. 32 0.04687 0.( )awidthshow |
---|
5923 | 224 162 gm |
---|
5924 | 0.40649 0. 32 0.04064 0.(Altschul, Stephen F. \(1991\). Amino acid substitution)awidthshow |
---|
5925 | 235 90 gm |
---|
5926 | 0.46875 0. 32 0.04687 0.( )awidthshow |
---|
5927 | 235 162 gm |
---|
5928 | 0.10742 0. 32 0.01074 0.(matrices from an information theoretic perspective. J. Mol.)awidthshow |
---|
5929 | 246 90 gm |
---|
5930 | 0.46295 0. 32 0.04629 0.( )awidthshow |
---|
5931 | 246 162 gm |
---|
5932 | 0.43884 0. 32 0.04388 0.(Biol. 219:555-565.)awidthshow |
---|
5933 | 290 90 gm |
---|
5934 | -0.11924 0.(Parameters:)ashow |
---|
5935 | 301 162 gm |
---|
5936 | -0.13816 0.(Which Database)ashow |
---|
5937 | 301 270 gm |
---|
5938 | -0.09788 0.(Which nucleic or amino acid database)ashow |
---|
5939 | 312 270 gm |
---|
5940 | -0.03448 0.(to search.)ashow |
---|
5941 | 334 162 gm |
---|
5942 | -0.18505 0.(Word Size)ashow |
---|
5943 | 334 270 gm |
---|
5944 | 0.17608 0. 32 0.01760 0.(Length of initial hit. after locating a match of)awidthshow |
---|
5945 | 345 270 gm |
---|
5946 | 0.27908 0. 32 0.02790 0.(this length, alignment extension is attempted.)awidthshow |
---|
5947 | 356 126 gm |
---|
5948 | -0.11082 0.(Blastn)ashow |
---|
5949 | 367 162 gm |
---|
5950 | -0.11381 0.(Match score)ashow |
---|
5951 | 367 270 gm |
---|
5952 | -0.03680 0.(Score for matches in secondary alignment extension)ashow |
---|
5953 | 378 162 gm |
---|
5954 | -0.04492 0.(Mismatch score)ashow |
---|
5955 | 378 270 gm |
---|
5956 | -0.02404 0.(Score for mismatches in secondary alignment extension)ashow |
---|
5957 | 400 126 gm |
---|
5958 | 0.49514 0. 32 0.04951 0.(Blastx, tblastn, blastp, blast3)awidthshow |
---|
5959 | 411 162 gm |
---|
5960 | 0.69580 0. 32 0.06958 0.(Substitution Matrix)awidthshow |
---|
5961 | 411 270 gm |
---|
5962 | 0.38192 0. 32 0.03819 0.(PAM120 or PAM250)awidthshow |
---|
5963 | 444 126 gm |
---|
5964 | 0.11117 0.(Comments:)ashow |
---|
5965 | 444 198 gm |
---|
5966 | -0.01263 0.(The report is loaded into a text editor. This should be saved as a new file)ashow |
---|
5967 | 455 198 gm |
---|
5968 | -0.01432 0.(as the default file is removed after execution. The latest version of blast can)ashow |
---|
5969 | 466 198 gm |
---|
5970 | 0.30914 0. 32 0.03091 0.(be obtained via anonymous ftp to ncbi.nlm.nih.gov.)awidthshow |
---|
5971 | F T cp |
---|
5972 | %%Page: ? 23 |
---|
5973 | op |
---|
5974 | 31 30 xl |
---|
5975 | 1 1 pen |
---|
5976 | 753 90 gm |
---|
5977 | (nc 31 30 761 582 6 rc)kp |
---|
5978 | 1 setTxMode |
---|
5979 | 0 fs |
---|
5980 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
5981 | 7 fz |
---|
5982 | 2 F /|______Times-Roman fnt |
---|
5983 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
5984 | 753 300 gm |
---|
5985 | 12 fz |
---|
5986 | 2 F /|______Times-Roman fnt |
---|
5987 | (23)show |
---|
5988 | 81 90 gm |
---|
5989 | 10 fz |
---|
5990 | 2 F /|______Times-Roman fnt |
---|
5991 | 0.14083 0. 32 0.01408 0.(FastA - Similarity search)awidthshow |
---|
5992 | 103 126 gm |
---|
5993 | -0.25508 0.(Reference:)ashow |
---|
5994 | 114 162 gm |
---|
5995 | 0.31677 0. 32 0.03167 0.(W. R. Pearson and D. J. Lipman \(1988\),)awidthshow |
---|
5996 | 125 162 gm |
---|
5997 | -0.00869 0.("Improved Tools for Biological Sequence Analysis", PNAS 85:2444-2448)ashow |
---|
5998 | 147 162 gm |
---|
5999 | 0.01358 0. 32 0.00135 0.(W. R. Pearson \(1990\) "Rapid and Sensitive Sequence)awidthshow |
---|
6000 | 158 162 gm |
---|
6001 | 0.26550 0. 32 0.02655 0.(Comparison with FASTP and FASTA" Methods in Enzymology 183:63-98)awidthshow |
---|
6002 | 180 126 gm |
---|
6003 | -0.11924 0.(Parameters:)ashow |
---|
6004 | 191 162 gm |
---|
6005 | -0.23434 0.(Database)ashow |
---|
6006 | 191 306 gm |
---|
6007 | -0.12551 0.(Which database to search)ashow |
---|
6008 | 202 162 gm |
---|
6009 | 0.05493 0. 32 0.00549 0.(Number of alignments to report)awidthshow |
---|
6010 | 213 162 gm |
---|
6011 | (SMATRIX)show |
---|
6012 | 213 306 gm |
---|
6013 | 0.26260 0. 32 0.02626 0.(Which similarity matrix to use)awidthshow |
---|
6014 | 246 126 gm |
---|
6015 | 0.11117 0.(Comments:)ashow |
---|
6016 | 257 90 gm |
---|
6017 | 0.47622 0. 32 0.04762 0.( )awidthshow |
---|
6018 | 257 162 gm |
---|
6019 | -0.05303 0.(The FastA package includes several additional programs for pairwise alignment.)ashow |
---|
6020 | 268 162 gm |
---|
6021 | -0.00224 0.(We have only included a bare bones link to FastA. We hope to include a more)ashow |
---|
6022 | 279 162 gm |
---|
6023 | -0.00607 0.(complete setup for the actual 2.2 release.)ashow |
---|
6024 | F T cp |
---|
6025 | %%Page: ? 24 |
---|
6026 | op |
---|
6027 | 31 30 xl |
---|
6028 | 1 1 pen |
---|
6029 | 753 90 gm |
---|
6030 | (nc 31 30 761 582 6 rc)kp |
---|
6031 | 1 setTxMode |
---|
6032 | 0 fs |
---|
6033 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
6034 | 7 fz |
---|
6035 | 2 F /|______Times-Roman fnt |
---|
6036 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
6037 | 753 300 gm |
---|
6038 | 12 fz |
---|
6039 | 2 F /|______Times-Roman fnt |
---|
6040 | (24)show |
---|
6041 | 81 90 gm |
---|
6042 | 10 fz |
---|
6043 | 2 F /|______Times-Roman fnt |
---|
6044 | 0.38360 0. 32 0.03836 0.(Assemble Contigs - CAP Contig Assembly Program)awidthshow |
---|
6045 | 103 126 gm |
---|
6046 | -0.04878 0.(Author - Xiaoqiu Huang)ashow |
---|
6047 | 114 162 gm |
---|
6048 | -0.03823 0.(Department of Computer Science)ashow |
---|
6049 | 125 162 gm |
---|
6050 | -0.02279 0.(Michigan Technological University)ashow |
---|
6051 | 136 162 gm |
---|
6052 | 0.34759 0. 32 0.03475 0.(Houghton, MI 49931)awidthshow |
---|
6053 | 147 162 gm |
---|
6054 | -0.01989 0.(E-mail: huang@cs.mtu.edu)ashow |
---|
6055 | 169 162 gm |
---|
6056 | 0.31494 0. 32 0.03149 0.(Minor modifications for I/O by S. Smith)awidthshow |
---|
6057 | 191 126 gm |
---|
6058 | -0.23449 0.(Reference -)ashow |
---|
6059 | 202 162 gm |
---|
6060 | 0.05538 0. 32 0.00553 0.("A Contig Assembly Program Based on Sensitive Detection of)awidthshow |
---|
6061 | 213 90 gm |
---|
6062 | ( )show |
---|
6063 | 213 162 gm |
---|
6064 | 0.00946 0. 32 0.00094 0.(Fragment Overlaps" \(submitted to Genomics, 1991\))awidthshow |
---|
6065 | 235 126 gm |
---|
6066 | -0.11924 0.(Parameters:)ashow |
---|
6067 | 246 162 gm |
---|
6068 | 0.21423 0. 32 0.02142 0.(Minimum overlap)awidthshow |
---|
6069 | 246 306 gm |
---|
6070 | -0.11988 0.(Number of bases required for overlap)ashow |
---|
6071 | 257 162 gm |
---|
6072 | -0.01672 0.(Percent match within overlap)ashow |
---|
6073 | 257 306 gm |
---|
6074 | -0.10456 0.(Percentage match required in the overlap)ashow |
---|
6075 | 268 306 gm |
---|
6076 | -0.07734 0.(region before merge is alowwed.)ashow |
---|
6077 | 290 126 gm |
---|
6078 | 0.11117 0.(Comments:)ashow |
---|
6079 | 312 162 gm |
---|
6080 | -0.06814 0.(CAP returns the aligned sequences to the current editor window. The sequences are)ashow |
---|
6081 | 323 162 gm |
---|
6082 | 0.00427 0. 32 0.00042 0.(placed into contigs by setting the groupid. Cap does not change the order of the)awidthshow |
---|
6083 | 334 162 gm |
---|
6084 | -0.05079 0.(sequences, and so the results should be sorted by group and offset \(see sort under the)ashow |
---|
6085 | 345 162 gm |
---|
6086 | -0.02096 0.(Edit menu\).)ashow |
---|
6087 | F T cp |
---|
6088 | %%Page: ? 25 |
---|
6089 | op |
---|
6090 | 31 30 xl |
---|
6091 | 1 1 pen |
---|
6092 | 753 90 gm |
---|
6093 | (nc 31 30 761 582 6 rc)kp |
---|
6094 | 1 setTxMode |
---|
6095 | 0 fs |
---|
6096 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
6097 | 7 fz |
---|
6098 | 2 F /|______Times-Roman fnt |
---|
6099 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
6100 | 753 300 gm |
---|
6101 | 12 fz |
---|
6102 | 2 F /|______Times-Roman fnt |
---|
6103 | (25)show |
---|
6104 | 92 90 gm |
---|
6105 | 10 fz |
---|
6106 | 2 F /|______Times-Roman fnt |
---|
6107 | -0.10661 0.(Lsadt - Least squares additive tree analysis)ashow |
---|
6108 | 114 90 gm |
---|
6109 | 0.18157 0. 32 0.01815 0.(Author: Geert De Soete, 'C' implementation by Mike Maciukenas University of Illinois)awidthshow |
---|
6110 | 136 90 gm |
---|
6111 | -0.00590 0.(Reference:LSADT, 1983 Psychometrika, 1984 Quality and Quantity)ashow |
---|
6112 | 158 90 gm |
---|
6113 | -0.11924 0.(Parameters:)ashow |
---|
6114 | 169 162 gm |
---|
6115 | -0.02085 0.(Distance correction to use in distance matrix calculations \(see count below\).)ashow |
---|
6116 | 180 162 gm |
---|
6117 | -0.03211 0.(What should be used for initial parameters estimates)ashow |
---|
6118 | 191 162 gm |
---|
6119 | -0.12921 0.(Random number seed)ashow |
---|
6120 | 202 162 gm |
---|
6121 | -0.05371 0.(Display method \(See TreeTool below\))ashow |
---|
6122 | 224 90 gm |
---|
6123 | 0.11117 0.(Comments:)ashow |
---|
6124 | 235 162 gm |
---|
6125 | -0.02113 0.(The program has been rewritten in 'C' and will be included with the rRNA Database)ashow |
---|
6126 | 246 162 gm |
---|
6127 | 0.03906 0. 32 0.00390 0.(phylogenetic package being written at the University of Illinois Department of)awidthshow |
---|
6128 | 257 162 gm |
---|
6129 | 0.04248 0.(Microbiology.)ashow |
---|
6130 | 279 162 gm |
---|
6131 | -0.01466 0.(Count is a short program to calculate a distance matrix from a sequence)ashow |
---|
6132 | 290 162 gm |
---|
6133 | -0.01652 0.(alignment \(see below\).)ashow |
---|
6134 | 334 90 gm |
---|
6135 | -0.00831 0.(Count - Distance matrix calculator)ashow |
---|
6136 | 356 90 gm |
---|
6137 | 0.45852 0. 32 0.04585 0.(Author: Steven Smith)awidthshow |
---|
6138 | 378 90 gm |
---|
6139 | -0.11924 0.(Parameters:)ashow |
---|
6140 | 389 162 gm |
---|
6141 | -0.07836 0.(Correction method)ashow |
---|
6142 | 389 306 gm |
---|
6143 | -0.01190 0.(Currently Jukes-Cantor or none)ashow |
---|
6144 | 400 162 gm |
---|
6145 | -0.17300 0.(Include dashed columns)ashow |
---|
6146 | 411 162 gm |
---|
6147 | -0.04403 0.(Match upper case to lower)ashow |
---|
6148 | 444 90 gm |
---|
6149 | 0.11117 0.(Comments:)ashow |
---|
6150 | 455 162 gm |
---|
6151 | -0.02917 0.(Passes back a distance matrix in a format readable by LSADT.)ashow |
---|
6152 | 510 90 gm |
---|
6153 | -0.06629 0.(Treetool - Tree drawing/manipulation)ashow |
---|
6154 | 532 90 gm |
---|
6155 | -0.01724 0.(Author:)ashow |
---|
6156 | 532 126 gm |
---|
6157 | 0.06912 0. 32 0.00691 0.(Michael Maciukenas, University of Illinois)awidthshow |
---|
6158 | 554 90 gm |
---|
6159 | 0.11117 0.(Comments:)ashow |
---|
6160 | 565 162 gm |
---|
6161 | -0.08711 0.(See included documentation for TreeTool usage.)ashow |
---|
6162 | F T cp |
---|
6163 | %%Page: ? 26 |
---|
6164 | op |
---|
6165 | 31 30 xl |
---|
6166 | 1 1 pen |
---|
6167 | 753 90 gm |
---|
6168 | (nc 31 30 761 582 6 rc)kp |
---|
6169 | 1 setTxMode |
---|
6170 | 0 fs |
---|
6171 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
6172 | 7 fz |
---|
6173 | 2 F /|______Times-Roman fnt |
---|
6174 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
6175 | 753 300 gm |
---|
6176 | 12 fz |
---|
6177 | 2 F /|______Times-Roman fnt |
---|
6178 | (26)show |
---|
6179 | 81 90 gm |
---|
6180 | 10 fz |
---|
6181 | 2 F /|______Times-Roman fnt |
---|
6182 | -0.10578 0.(Readseq - format conversion program)ashow |
---|
6183 | 103 90 gm |
---|
6184 | -0.01724 0.(Author:)ashow |
---|
6185 | 103 162 gm |
---|
6186 | (Don Gilbert)show |
---|
6187 | 125 90 gm |
---|
6188 | -0.11924 0.(Parameters:)ashow |
---|
6189 | 125 162 gm |
---|
6190 | 0.05798 0. 32 0.00579 0.(Many, but can easily be run in interactive mdoe.)awidthshow |
---|
6191 | 147 90 gm |
---|
6192 | 0.11117 0.(Comments:)ashow |
---|
6193 | 158 162 gm |
---|
6194 | -0.02134 0.(Readseq is a very useful program for format conversion. The latest versionsupports over a)ashow |
---|
6195 | 169 162 gm |
---|
6196 | -0.01359 0.(dozen different file formats, as well as formating capabilities for publication. GDE makes)ashow |
---|
6197 | 180 162 gm |
---|
6198 | -0.02366 0.(of Readseq for importing and exporting seqeuences as well as a filtering tool to some)ashow |
---|
6199 | 191 162 gm |
---|
6200 | -0.02290 0.(external functions.)ashow |
---|
6201 | 246 90 gm |
---|
6202 | -0.10661 0.(Lsadt - Least squares additive tree analysis)ashow |
---|
6203 | 268 90 gm |
---|
6204 | 0.18157 0. 32 0.01815 0.(Author: Geert De Soete, 'C' implementation by Mike Maciukenas University of Illinois)awidthshow |
---|
6205 | 290 90 gm |
---|
6206 | -0.00590 0.(Reference:LSADT, 1983 Psychometrika, 1984 Quality and Quantity)ashow |
---|
6207 | 312 90 gm |
---|
6208 | -0.11924 0.(Parameters:)ashow |
---|
6209 | 323 162 gm |
---|
6210 | -0.02085 0.(Distance correction to use in distance matrix calculations \(see count below\).)ashow |
---|
6211 | 334 162 gm |
---|
6212 | -0.03211 0.(What should be used for initial parameters estimates)ashow |
---|
6213 | 345 162 gm |
---|
6214 | -0.12921 0.(Random number seed)ashow |
---|
6215 | 356 162 gm |
---|
6216 | -0.05371 0.(Display method \(See TreeTool below\))ashow |
---|
6217 | 378 90 gm |
---|
6218 | 0.11117 0.(Comments:)ashow |
---|
6219 | 389 162 gm |
---|
6220 | -0.02113 0.(The program has been rewritten in 'C' and will be included with the rRNA Database)ashow |
---|
6221 | 400 162 gm |
---|
6222 | 0.03906 0. 32 0.00390 0.(phylogenetic package being written at the University of Illinois Department of)awidthshow |
---|
6223 | 411 162 gm |
---|
6224 | 0.04248 0.(Microbiology.)ashow |
---|
6225 | 433 162 gm |
---|
6226 | -0.01466 0.(Count is a short program to calculate a distance matrix from a sequence)ashow |
---|
6227 | 444 162 gm |
---|
6228 | -0.01652 0.(alignment \(see below\).)ashow |
---|
6229 | 488 90 gm |
---|
6230 | -0.00831 0.(Count - Distance matrix calculator)ashow |
---|
6231 | 510 90 gm |
---|
6232 | 0.45852 0. 32 0.04585 0.(Author: Steven Smith)awidthshow |
---|
6233 | 532 90 gm |
---|
6234 | -0.11924 0.(Parameters:)ashow |
---|
6235 | 543 162 gm |
---|
6236 | -0.07836 0.(Correction method)ashow |
---|
6237 | 543 306 gm |
---|
6238 | -0.01190 0.(Currently Jukes-Cantor or none)ashow |
---|
6239 | 554 162 gm |
---|
6240 | -0.17300 0.(Include dashed columns)ashow |
---|
6241 | 565 162 gm |
---|
6242 | -0.04403 0.(Match upper case to lower)ashow |
---|
6243 | 598 90 gm |
---|
6244 | 0.11117 0.(Comments:)ashow |
---|
6245 | 609 162 gm |
---|
6246 | -0.02917 0.(Passes back a distance matrix in a format readable by LSADT.)ashow |
---|
6247 | F T cp |
---|
6248 | %%Page: ? 27 |
---|
6249 | op |
---|
6250 | 31 30 xl |
---|
6251 | 1 1 pen |
---|
6252 | 753 90 gm |
---|
6253 | (nc 31 30 761 582 6 rc)kp |
---|
6254 | 1 setTxMode |
---|
6255 | 0 fs |
---|
6256 | {}mark T /Times-Roman /|______Times-Roman 0 rf |
---|
6257 | 7 fz |
---|
6258 | 2 F /|______Times-Roman fnt |
---|
6259 | 0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow |
---|
6260 | 753 300 gm |
---|
6261 | 12 fz |
---|
6262 | 2 F /|______Times-Roman fnt |
---|
6263 | (27)show |
---|
6264 | 92 90 gm |
---|
6265 | -0.10993 0.(Copyright Notice)ashow |
---|
6266 | 115 90 gm |
---|
6267 | 10 fz |
---|
6268 | 2 F /|______Times-Roman fnt |
---|
6269 | -0.01510 0.(The Genetic Data Environment \(GDE\) software and documentation are not in the public domain. Portions)ashow |
---|
6270 | 126 90 gm |
---|
6271 | -0.04327 0.(of this code are owned and copyrighted by the The Board of Trustees of the University of Illinois and by)ashow |
---|
6272 | 137 90 gm |
---|
6273 | 0.04196 0. 32 0.00419 0.(Steven Smith. External functions used by GDE are the proporty of, their respective authors. This release of)awidthshow |
---|
6274 | 148 90 gm |
---|
6275 | -0.02386 0.(the GDE program and documentation may not be sold, or incorporated into a commercial product, in whole)ashow |
---|
6276 | 159 90 gm |
---|
6277 | 0.10650 0. 32 0.01065 0.(or in part without the expressed written consent of the University of Illinois and of its author, Steven)awidthshow |
---|
6278 | 170 90 gm |
---|
6279 | 0.32122 0.(Smith.)ashow |
---|
6280 | 192 90 gm |
---|
6281 | -0.01826 0.(All interested parties may redistribute the GDE as long as all copies are accompanied by this)ashow |
---|
6282 | 203 90 gm |
---|
6283 | 0.05432 0. 32 0.00543 0.(documentation, and all copyright notices remain intact. Parties interested in redistribution must do so on a)awidthshow |
---|
6284 | 214 90 gm |
---|
6285 | -0.03430 0.(non-profit basis, charging only for cost of media. Modifications to the GDE core editor should be forwarded)ashow |
---|
6286 | 225 90 gm |
---|
6287 | 0.05264 0. 32 0.00526 0.(to the author Steven Smith. External programs used by the GDE are copyright by, and are the property of)awidthshow |
---|
6288 | 236 90 gm |
---|
6289 | -0.03063 0.(their respective authors unless otherwise stated.)ashow |
---|
6290 | 269 90 gm |
---|
6291 | 0.02899 0. 32 0.00289 0.(While all attempts have been made to insure the integrity of these programs:)awidthshow |
---|
6292 | 291 90 gm |
---|
6293 | 12 fz |
---|
6294 | 2 F /|______Times-Roman fnt |
---|
6295 | -0.29307 0.(Disclaimer)ashow |
---|
6296 | 314 90 gm |
---|
6297 | 10 fz |
---|
6298 | 2 F /|______Times-Roman fnt |
---|
6299 | (THE UNIVERSITY OF ILLINOIS, HARVARD UNIVERSITY AND THE AUTHOR, STEVEN SMITH)show |
---|
6300 | 325 90 gm |
---|
6301 | 0.21240 0. 32 0.02124 0.(GIVE NO WARRANTIES, EXPRESSED OR IMPLIED FOR THE SOFTWARE AND)awidthshow |
---|
6302 | 336 90 gm |
---|
6303 | -0.03628 0.(DOCUMENTATION PROVIDED, INCLUDING, BUT NOT LIMITED TO WARRANTY OF)ashow |
---|
6304 | 347 90 gm |
---|
6305 | 0.20996 0. 32 0.02099 0.(MERCHANTABILITY AND WARRANTY OF FITNESS FOR A PARTICULAR PURPOSE. User)awidthshow |
---|
6306 | 358 90 gm |
---|
6307 | -0.06015 0.(understands the software is a research tool for which no warranties as to capabilities or accuracy are made,)ashow |
---|
6308 | 369 90 gm |
---|
6309 | -0.01759 0.(and user accepts the software "as is." User assumes the entire risk as to the results and performance of the)ashow |
---|
6310 | 380 90 gm |
---|
6311 | -0.05845 0.(software and documentation. The above parties cannot be held liable for any direct, indirect, consequential)ashow |
---|
6312 | 391 90 gm |
---|
6313 | -0.00201 0.(or incidental damages with respect to any claim by user or any third party on account of, or arising from the)ashow |
---|
6314 | 402 90 gm |
---|
6315 | -0.05157 0.(use of software and associated materials. This disclaimer covers both the GDE core editor and all external)ashow |
---|
6316 | 413 90 gm |
---|
6317 | -0.01464 0.(programs used by the GDE.)ashow |
---|
6318 | F T cp |
---|
6319 | %%Trailer |
---|
6320 | cd |
---|
6321 | end |
---|
6322 | %%Pages: 27 0 |
---|
6323 | %%EOF |
---|
6324 | |
---|