source: tags/initial/GDE/SUPPORT/CAP2.c

Last change on this file was 2, checked in by oldcode, 26 years ago

Initial revision

  • Property svn:eol-style set to native
  • Property svn:keywords set to Author Date Id Revision
File size: 58.7 KB
Line 
1/* CONTIG ASSEMBLY PROGRAM (CAP)
2
3   copyright (c) 1991   Xiaoqiu Huang
4   The distribution of the program is granted provided no charge
5   is made and the copyright notice is included.
6
7   Proper attribution of the author as the source of the software
8   would be appreciated:
9   "A Contig Assembly Program Based on Sensitive Detection of
10   Fragment Overlaps" (submitted to Genomics, 1991)
11        Xiaoqiu Huang
12        Department of Computer Science
13        Michigan Technological University
14        Houghton, MI 49931
15        E-mail: huang@cs.mtu.edu
16
17   The CAP program uses a dynamic programming algorithm to compute
18   the maximal-scoring overlapping alignment between two fragments.
19   Fragments in random orientations are assembled into contigs by a
20   greedy approach in order of the overlap scores. CAP is efficient
21   in computer memory: a large number of arbitrarily long fragments
22   can be assembled. The time requirement is acceptable; for example,
23   CAP took 4 hours to assemble 1015 fragments of a total of 252 kb
24   nucleotides on a Sun SPARCstation SLC. The program is written in C
25   and runs on Sun workstations.
26
27   Below is a description of the parameters in the #define section of CAP.
28   Two specially chosen sets of substitution scores and indel penalties
29   are used by the dynamic programming algorithm: heavy set for regions
30   of low sequencing error rates and light set for fragment ends of high
31   sequencing error rates. (Use integers only.)
32        Heavy set:                       Light set:
33
34        MATCH     =  2                   MATCH     =  2
35        MISMAT    = -6                   LTMISM    = -3
36        EXTEND    =  4                   LTEXTEN   =  2
37
38    In the initial assembly, any overlap must be of length at least OVERLEN,
39    and any overlap/containment must be of identity percentage at least
40    PERCENT. After the initial assembly, the program attempts to join
41    contigs together using weak overlaps. Two contigs are merged if the
42    score of the overlapping alignment is at least CUTOFF. The value for
43    CUTOFF is chosen according to the value for MATCH.
44
45    DELTA is a parameter in necessary conditions for overlap/containment.
46    Those conditions are used to quickly reject pairs of fragments that
47    could not possibly have an overlap/containment relationship.
48    The dynamic programming algorithm is only applied to pairs of fragments
49    that pass the screening. A large value for DELTA means stringent
50    conditions, where the value for DELTA is a real number at least 8.0.
51
52    POS5 and POS3 are fragment positions such that the 5' end between base 1
53    and base POS5, and the 3' end after base POS3 are of high sequencing
54    error rates, say more than 5%. For mismatches and indels occurring in
55    the two ends, light penalties are used.
56
57    A file of input fragments looks like:
58>G019uabh
59ATACATCATAACACTACTTCCTACCCATAAGCTCCTTTTAACTTGTTAAA
60GTCTTGCTTGAATTAAAGACTTGTTTAAACACAAAAATTTAGAGTTTTAC
61TCAACAAAAGTGATTGATTGATTGATTGATTGATTGATGGTTTACAGTAG
62GACTTCATTCTAGTCATTATAGCTGCTGGCAGTATAACTGGCCAGCCTTT
63AATACATTGCTGCTTAGAGTCAAAGCATGTACTTAGAGTTGGTATGATTT
64ATCTTTTTGGTCTTCTATAGCCTCCTTCCCCATCCCCATCAGTCTTAATC
65AGTCTTGTTACGTTATGACTAATCTTTGGGGATTGTGCAGAATGTTATTT
66TAGATAAGCAAAACGAGCAAAATGGGGAGTTACTTATATTTCTTTAAAGC
67>G028uaah
68CATAAGCTCCTTTTAACTTGTTAAAGTCTTGCTTGAATTAAAGACTTGTT
69TAAACACAAAATTTAGACTTTTACTCAACAAAAGTGATTGATTGATTGAT
70TGATTGATTGATGGTTTACAGTAGGACTTCATTCTAGTCATTATAGCTGC
71TGGCAGTATAACTGGCCAGCCTTTAATACATTGCTGCTTAGAGTCAAAGC
72ATGTACTTAGAGTTGGTATGATTTATCTTTTTGGTCTTCTATAGCCTCCT
73TCCCCATCCCATCAGTCT
74>G022uabh
75TATTTTAGAGACCCAAGTTTTTGACCTTTTCCATGTTTACATCAATCCTG
76TAGGTGATTGGGCAGCCATTTAAGTATTATTATAGACATTTTCACTATCC
77CATTAAAACCCTTTATGCCCATACATCATAACACTACTTCCTACCCATAA
78GCTCCTTTTAACTTGTTAAAGTCTTGCTTGAATTAAAGACTTGTTTAAAC
79ACAAAATTTAGACTTTTACTCAACAAAAGTGATTGATTGATTGATTGATT
80GATTGAT
81>G023uabh
82AATAAATACCAAAAAAATAGTATATCTACATAGAATTTCACATAAAATAA
83ACTGTTTTCTATGTGAAAATTAACCTAAAAATATGCTTTGCTTATGTTTA
84AGATGTCATGCTTTTTATCAGTTGAGGAGTTCAGCTTAATAATCCTCTAC
85GATCTTAAACAAATAGGAAAAAAACTAAAAGTAGAAAATGGAAATAAAAT
86GTCAAAGCATTTCTACCACTCAGAATTGATCTTATAACATGAAATGCTTT
87TTAAAAGAAAATATTAAAGTTAAACTCCCCTATTTTGCTCGTTTTTGCTT
88ATCTAAAATACATTCTGCACAATCCCCAAAGATTGATCATACGTTAC
89>G006uaah
90ACATAAAATAAACTGTTTTCTATGTGAAAATTAACCTANNATATGCTTTG
91CTTATGTTTAAGATGTCATGCTTTTTATCAGTTGAGGAGTTCAGCTTAAT
92AATCCTCTAAGATCTTAAACAAATAGGAAAAAAACTAAAAGTAGAAAATG
93GAAATAAAATGTCAAAGCATTTCTACCACTCAGAATTGATCTTATAACAT
94GAAATGCTTTTTAAAAGAAAATATTAAAGTTAAACTCCCC
95   A string after ">" is the name of the following fragment.
96   Only the five upper-case letters A, C, G, T and N are allowed
97   to appear in fragment data. No other characters are allowed.
98   A common mistake is the use of lower case letters in a fragment.
99
100   To run the program, type a command of form
101
102        cap  file_of_fragments 
103
104   The output goes to the terminal screen. So redirection of the
105   output into a file is necessary. The output consists of three parts:
106   overview of contigs at fragment level, detailed display of contigs
107   at nucleotide level, and consensus sequences.
108   '+' = direct orientation; '-' = reverse complement
109   The output of CAP on the sample input data looks like:
110
111#Contig 1
112
113#G022uabh+(0)
114TATTTTAGAGACCCAAGTTTTTGACCTTTTCCATGTTTACATCAATCCTGTAGGTGATTG
115GGCAGCCATTTAAGTATTATTATAGACATTTTCACTATCCCATTAAAACCCTTTATGCCC
116ATACATCATAACACTACTTCCTACCCATAAGCTCCTTTTAACTTGTTAAAGTCTTGCTTG
117AATTAAAGACTTGTTTAAACACAAAA-TTTAGACTTTTACTCAACAAAAGTGATTGATTG
118ATTGATTGATTGATTGAT
119#G028uaah+(145)
120CATAAGCTCCTTTTAACTTGTTAAAGTCTTGCTTGAATTAAAGACTTGTTTAAACACAAA
121A-TTTAGACTTTTACTCAACAAAAGTGATTGATTGATTGATTGATTGATTGATGGTTTAC
122AGTAGGACTTCATTCTAGTCATTATAGCTGCTGGCAGTATAACTGGCCAGCCTTTAATAC
123ATTGCTGCTTAGAGTCAAAGCATGTACTTAGAGTTGGTATGATTTATCTTTTTGGTCTTC
124TATAGCCTCCTTCCCCATCCC-ATCAGTCT
125#G019uabh+(120)
126ATACATCATAACACTACTTCCTACCCATAAGCTCCTTTTAACTTGTTAAAGTCTTGCTTG
127AATTAAAGACTTGTTTAAACACAAAAATTTAGAGTTTTACTCAACAAAAGTGATTGATTG
128ATTGATTGATTGATTGATGGTTTACAGTAGGACTTCATTCTAGTCATTATAGCTGCTGGC
129AGTATAACTGGCCAGCCTTTAATACATTGCTGCTTAGAGTCAAAGCATGTACTTAGAGTT
130GGTATGATTTATCTTTTTGGTCTTCTATAGCCTCCTTCCCCATCCCCATCAGTCTTAATC
131AGTCTTGTTACGTTATGACT-AATCTTTGGGGATTGTGCAGAATGTTATTTTAGATAAGC
132AAAA-CGAGCAAAAT-GGGGAGTT-A-CTT-A-TATTT-CTTT-AAA--GC
133#G023uabh-(426)
134GTAACGT-ATGA-TCAATCTTTGGGGATTGTGCAGAATGT-ATTTTAGATAAGCAAAAAC
135GAGCAAAATAGGGGAGTTTAACTTTAATATTTTCTTTTAAAAAGCATTTCATGTTATAAG
136ATCAATTCTGAGTGGTAGAAATGCTTTGACATTTTATTTCCATTTTCTACTTTTAGTTTT
137TTTCCTATTTGTTTAAGATCGTAGAGGATTATTAAGCTGAACTCCTCAACTGATAAAAAG
138CATGACATCTTAAACATAAGCAAAGCATATTTTTAGGTTAATTTTCACATAGAAAACAGT
139TTATTTTATGTGAAATTCTATGTAGATATACTATTTTTTTGGTATTTATT
140#G006uaah-(496)
141GGGGAGTTTAACTTTAATATTTTCTTTTAAAAAGCATTTCATGTTATAAGATCAATTCTG
142AGTGGTAGAAATGCTTTGACATTTTATTTCCATTTTCTACTTTTAGTTTTTTTCCTATTT
143GTTTAAGATCTTAGAGGATTATTAAGCTGAACTCCTCAACTGATAAAAAGCATGACATCT
144TAAACATAAGCAAAGCATATNNT-AGGTTAATTTTCACATAGAAAACAGTTTATTTTATG
145T
146
147
148
149Slight modifications by S. Smith on Mon Feb 17 10:18:34 EST 1992.
150These changes allow for command line arguements for several
151of the hard coded parameters, as well as a slight modification to
152the output routine to support GDE format.  Changes are commented
153as:
154
155Mod by S.S.
156
157*/
158
159#include   <stdio.h>
160
161int OVERLEN;        /* Minimum length of any overlap */
162float PERCENT;      /* Minimum identity percentage of any overlap */
163#define  CUTOFF    50           /* cutoff score for overlap or containment */
164#define  DELTA     9.0          /* Jump increment in check for overlap */
165#define  MATCH     2            /* score of a match */
166#define  MISMAT   -6            /* score of a mismatch */
167#define  LTMISM   -3            /* light score of a mismatch */
168#define  OPEN      0            /* gap open penalty */
169#define  EXTEND    4            /* gap extension penalty */
170#define  LTEXTEN   2            /* light gap extension penalty */
171#define  POS5      30           /* Sequencing errors often occur before base POS5 */
172#define  POS3      475          /* Sequencing errors often occur after base POS3 */
173#define  LINELEN   60           /* length of one printed line */
174#define  NAMELEN   20           /* length of printed fragment name */
175#define  TUPLELEN  4            /* Maximum length of words for lookup table */
176#define  SEQLEN    2000         /* initial size of an array for an output fragment */
177
178static int over_len;
179static float per_cent;
180typedef struct OVERLAP          /* of 5' and 3' segments */
181{ 
182        int    number;  /* index of 3' segment   */
183        int    host;            /* index of 5' segment   */
184        int    ind;             /* used in reassembly */
185        int    stari;   /* start position of 5' suffix */
186        int    endi;            /* end position of 5' suffix   */
187        int    starj;   /* start position of 3' prefix */
188        int    endj;            /* end position of 3' prefix   */
189        short   orienti;        /* orientation of 5' segment: 0= rev. */
190        short   orientj;        /* orientation of 3' segment: 0= rev. */
191        int    score;   /* score of overlap alignment */
192        int    length;  /* length of alignment      */
193        int    match;   /* number of matches in alignment */
194        short   kind;   /* 0 = containment; 1 = overlap   */
195        int    *script; /* script for constructing alignment */
196        struct  OVERLAP  *next; 
197} over, *overptr;
198struct SEG
199{ 
200        char    *name;  /* name string */
201        int     len;            /* length of segment name */
202        char    *seq;   /* segment sequence */
203        char    *rev;   /* reverse complement */
204        int     length; /* length of sequence */
205        short   kind;   /* 0 = contain; 1 = overlap */
206        int     *lookup;        /* lookup table */
207        int     *pos;   /* location list */
208        overptr list;   /* list of overlapping edges */
209} *segment;     /* array of segment records */
210int   seg_num;                  /* The number of segments   */
211overptr   *edge;                /* set of overlapping edges */
212int   edge_num;                 /* The number of overlaps */
213struct CONS                     /* 1 = itself; 0 = reverse complement */
214{ 
215        short   isfive[2];      /* is 5' end free? */
216        short   isthree[2];     /* is 3' end free? */
217        short   orient[2];      /* orientation of 3' segment */
218        int     group;  /* contig serial number */
219        int     next[2];        /* pointer to 3' adjacent segment */
220        int     other;  /* the other end of the contig   */
221        int     child;  /* for the containment tree   */
222        int     brother;
223        int     father;
224        overptr node[2];        /* pointers to overlapping edges */
225} *contigs;  /* list of contigs */
226struct TTREE                    /* multiple alignment tree */
227{ 
228        short   head;   /* head = 1 means the head of a contig */
229        short   orient; /* orientation */
230        int     begin;  /* start position of previous segment */
231        int     *script;        /* alignment script */
232        int     size;   /* length of script */
233        int     next;   /* list of overlap segments */
234        int     child;  /* list of child segments */
235        int     brother;        /* list of sibling segments */
236}  *mtree;
237int   vert[128];                /* converted digits for 'A','C','G','T' */
238int   vertc[128];               /* for reverse complement */
239int   tuple;                    /* tuple = TUPLELEN - 1 */
240int  base[TUPLELEN];            /* locations of a lookup table */
241int  power[TUPLELEN];           /* powers of 4 */
242typedef struct OUT
243{ 
244        char  *line;            /* one print line */
245        char  *a;               /* pointer to slot in line */
246        char  c;                /* current char */
247        char  *seq;             /* pointer to sequence */
248        int   length;           /* length of segment */
249        int   id;               /* index of segment */
250        int   *s;               /* pointer to script vector */
251        int   size;             /* size of script vector */
252        int   op;               /* current operation */
253        char  name[NAMELEN+2];/* name of segment */
254        short done;             /* indicates if segment is done */
255        int   loc;              /* position of next segment symbol */
256        char  kind;             /* type of next symbol of segment */
257        char  up;               /* type of upper symbol of operation */
258        char  dw;               /* type of lower symbol of operation */
259        int   offset;           /* relative to consensus sequence */
260        int   linesize; /* size of array line */
261        struct  OUT *child;     /* pointer to child subtree */
262        struct  OUT *brother;   /* pointer to brother node */
263        struct  OUT *link;      /* for operation linked list */
264        struct  OUT *father;    /* pointer to father node */
265}  row, *rowptr;        /* node for segment */
266rowptr *work;                   /* a set of working segments */
267rowptr head, tail;              /* first and last nodes of op list */
268struct VX
269{ 
270        int     id;                     /* Segment index */
271        short   kind;           /* overlap or containment */
272        overptr list;           /* list of overlapping edges */
273} *piece;               /* array of segment records */
274char  *allconsen, *allconpt;            /* Storing consensus sequences */
275
276main(argc, argv) int argc; 
277char *argv[];
278{ 
279        int   M;                                /* Sequence length */
280        int  V[128][128], Q,R;          /* Weights  */
281        int  V1[128][128], R1;          /* Light weights  */
282        int   total;                            /* Total of segment lengths */
283        int   number;                         /* The number of segments   */
284        char  *sequence;                        /* Storing all segments     */
285        char  *reverse;                 /* Storing all reverse segments */
286        int   symbol, prev;                     /* The next character         */
287        FILE *Ap, *ckopen();                  /* For the sequence file      */
288        char *my_calloc(int);                   /* space-allocating function  */
289        register int  i, j, k;          /* index variables            */
290        /* Mod by S.S. */
291        int jj;
292        short  heading;                 /* 1: heading; 0: sequence    */
293
294        /*
295*       Mod by S.S.
296*
297        if ( argc != 2 )
298                fatalf("The proper form of command is: \n%s file_of_fragments",
299                         argv[0]);
300*/
301        if ( argc != 4 )
302                fatalf("usage: %s file_of_fragments MIN_OVERLAP PERCENT_MATCH",
303                    argv[0]);
304        sscanf(argv[2],"%d",&OVERLEN);
305        sscanf(argv[3],"%d",&jj);
306        PERCENT = (float)jj/100.0;
307        if(PERCENT < 0.25) PERCENT = 0.25;
308        if(PERCENT > 1.0) PERCENT = 1.0;
309        if(OVERLEN < 1) OVERLEN = 1;
310        if(OVERLEN > 100) OVERLEN = 100;
311
312
313
314        /* determine number of segments and total lengths */
315        j = 0;
316
317        Ap = ckopen(argv[1], "r");
318        prev = '\n';
319        for (total = 3, number = 0; ( symbol = getc(Ap)) != EOF ; total++ )
320        { 
321                if ( symbol == '>' && prev == '\n' )
322                        number++;
323                prev = symbol;
324        }
325        (void)  fclose(Ap);
326
327        total += number * 20;
328        /* allocate space for segments */
329        sequence = ( char * ) my_calloc( total * sizeof(char));
330        reverse = ( char * ) my_calloc( total * sizeof(char));
331        allconpt = allconsen = ( char * ) my_calloc( total * sizeof(char));
332        segment = ( struct SEG * ) my_calloc( number * sizeof(struct SEG));
333
334        /* read the segments into sequence */
335        M = 0;
336        Ap = ckopen(argv[1], "r");
337        number = -1;
338        heading = 0;
339        prev = '\n';
340        for ( i = 0, k = total ; ( symbol = getc(Ap)) != EOF ; )
341        { 
342                if ( symbol != '\n' )
343                { 
344                        sequence[++i] = symbol;
345                        switch ( symbol )
346                        { 
347                        case 'A' : 
348                                reverse[--k] = 'T'; 
349                                break;
350                        case 'a' : 
351                                reverse[--k] = 't'; 
352                                break;
353                        case 'T' : 
354                                reverse[--k] = 'A'; 
355                                break;
356                        case 't' : 
357                                reverse[--k] = 'a'; 
358                                break;
359                        case 'C' : 
360                                reverse[--k] = 'G'; 
361                                break;
362                        case 'c' : 
363                                reverse[--k] = 'g'; 
364                                break;
365                        case 'G' : 
366                                reverse[--k] = 'C'; 
367                                break;
368                        case 'g' : 
369                                reverse[--k] = 'c'; 
370                                break;
371                        default  : 
372                                reverse[--k] = symbol; 
373                                break;
374                        }
375                }
376                if ( symbol == '>' && prev == '\n' )
377                { 
378                        heading = 1;
379                        if ( number >= 0 )
380                        { 
381                                segment[number].length = i - j - 1;
382                                segment[number].rev = &(reverse[k]);
383                                if ( i - j - 1 > M ) M = i - j -1;
384                        }
385                        number++;
386                        j = i;
387                        segment[number].name = &(sequence[i]);
388                        segment[number].kind = 1;
389                        segment[number].list = 0;
390                }
391                if ( heading && symbol == '\n' )
392                { 
393                        heading = 0;
394                        segment[number].len = i - j;
395                        segment[number].seq = &(sequence[i]);
396                        j = i;
397                }
398
399                prev = symbol;
400        }
401        segment[number].length = i - j;
402        reverse[--k] = '>';
403        segment[number].rev = &(reverse[k]);
404        if ( i - j > M ) M = i - j;
405        seg_num = ++number;
406        (void)  fclose(Ap);
407
408        Q = OPEN;
409        R = EXTEND;
410        R1 = LTEXTEN;
411        /* set match and mismatch weights */
412        for ( i = 0; i < 128 ; i++ )
413                for ( j = 0; j < 128 ; j++ )
414                        if ((i|32) == (j|32) )
415                                V[i][j] = V1[i][j] = MATCH;
416                        else
417                        { 
418                                V[i][j] = MISMAT;
419                                V1[i][j] = LTMISM;
420                        }
421        for ( i = 0; i < 128 ; i++ )
422                V['N'][i] = V[i]['N'] = MISMAT + 1;
423        V1['N']['N'] = MISMAT + 1;
424
425        over_len = OVERLEN;
426        per_cent = PERCENT;
427        edge_num = 0;
428        INIT(M);
429        MAKE();
430        PAIR(V,V1,Q,R,R1);
431        ASSEM();
432        REPAIR();
433        FORM_TREE();
434        /* GRAPH(); */
435        SHOW();
436}
437
438static int  (*v)[128];                  /* substitution scores */
439static int  q, r;                       /* gap penalties */
440static int  qr;                         /* qr = q + r */
441static int  (*v1)[128];                 /* light substitution scores */
442static int  r1;                         /* light extension penalty */
443static int  qr1;                        /* qr1 = q + r1 */
444
445static int   SCORE;
446static int   STARI;
447static int   STARJ;
448static int   ENDI;
449static int   ENDJ;
450
451static int  *CC, *DD;                   /* saving matrix scores */
452static int  *RR, *SS;                   /* saving start-points */
453static int   *S;                        /* saving operations for diff */
454
455/* The following definitions are for function diff() */
456
457int   diff();
458static int   zero = 0;                          /* int  type zero        */
459
460#define gap(k)  ((k) <= 0 ? 0 : q+r*(k))        /* k-symbol indel score */
461
462static int  *sapp;                              /* Current script append ptr */
463static int   last;                              /* Last script op appended */
464
465static int  no_mat;                             /* number of matches */
466
467static int  no_mis;                             /* number of mismatches */
468
469static int  al_len;                             /* length of alignment */
470/* Append "Delete k" op */
471#define DEL(k)                          \
472{ al_len += k;                          \
473  if (last < 0)                         \
474    last = sapp[-1] -= (k);             \
475  else                                  \
476    last = *sapp++ = -(k);              \
477}
478/* Append "Insert k" op */
479#define INS(k)                          \
480{ al_len += k;                          \
481  if (last < 0)                         \
482    { sapp[-1] = (k); *sapp++ = last; } \
483  else                                  \
484    last = *sapp++ = (k);               \
485}
486
487/* Append "Replace" op */
488#define REP                             \
489{ last = *sapp++ = 0;                   \
490  al_len += 1;                          \
491}
492
493INIT(M) int  M;
494{ 
495        register  int   j;                      /* row and column indices */
496        char *my_calloc();                      /* space-allocating function */
497
498        /* allocate space for all vectors */
499        j = (M + 1) * sizeof(int );
500        CC = ( int  * ) my_calloc(j);
501        DD = ( int  * ) my_calloc(j);
502        RR = ( int  * ) my_calloc(j);
503        SS = ( int  * ) my_calloc(j);
504        S = ( int  * ) my_calloc(2 * j);
505}
506
507/* Make a lookup table for words of lengths up to TUPLELEN in each sequence.
508   The value of a word is used as an index to the table.  */
509MAKE()
510{ 
511        int   hash[TUPLELEN];           /* values of words of lengths up to TUPLELEN */
512        int   *table;                   /* pointer to a lookup table */
513        int   *loc;                     /* pointer to a table of sequence locations */
514        int   size;                     /* size of a lookup table */
515        int   limit, digit, step;       /* temporary variables  */
516        register  int  i, j, k, p, q;   /* index varibles */
517        char *my_calloc();              /* space-allocating function */
518        char *A;                        /* pointer to a sequence */
519        int  M;                 /* length of a sequence */
520
521        tuple = TUPLELEN - 1;
522        for ( i = 0; i < 128; i++ )
523                vert[i] = 4;
524        vert['A'] = vert['a'] = 0;
525        vert['C'] = vert['c'] = 1;
526        vert['G'] = vert['g'] = 2;
527        vert['T'] = vert['t'] = 3;
528        vertc['A'] = vertc['a'] = 3;
529        vertc['C'] = vertc['c'] = 2;
530        vertc['G'] = vertc['g'] = 1;
531        vertc['T'] = vertc['t'] = 0;
532        for ( i = 0, j = 1, size = 0; i <= tuple ; i++, j *= 4 )
533        { 
534                base[i] = size;
535                power[i] = j;
536                size = ( size + 1 ) * 4;
537        }
538        for ( j = 0; j <= tuple; j++ )
539                hash[j] = 0;
540        /* make a lookup table for each sequence */
541        for ( i = 0; i < seg_num ; i++ )
542        { 
543                A = segment[i].seq;
544                M = segment[i].length;
545                table = segment[i].lookup = (int  * ) my_calloc(size * sizeof(int ));
546                loc = segment[i].pos = (int  * ) my_calloc((M + 1) * sizeof(int ));
547                for ( j = 0; j < size; j++ )
548                        table[j] = 0;
549                for ( k = 0, j = 1; j <= M; j++ )
550                        if ( ( digit = vert[A[j]] ) != 4 )
551                        { 
552                                for ( p = tuple; p > 0; p-- )
553                                        hash[p] = 4 * (hash[p-1] + 1) + digit;
554                                hash[0] = digit;
555                                step = j - k;
556                                limit = tuple <= step ? tuple : step;
557                                for ( p = 0; p < limit; p++ )
558                                        if ( ! table[(q = hash[p])] )  table[q] = 1;
559                                if ( step > tuple )
560                                { 
561                                        loc[(p = j - tuple)] = table[(q = hash[tuple])];
562                                        table[q] = p;
563                                }
564                        }
565                        else
566                                k = j;
567        }
568}
569
570/* Perform pair-wise comparisons of sequences. The sequences not
571   satisfying the necessary condition for overlap are rejected quickly.
572   Those that do satisfy the condition are verified with a dynamic
573   programming algorithm to see if overlaps exist. */
574PAIR(V,V1,Q,R,R1) int  V[][128],V1[][128],Q,R,R1;
575{ 
576        int  endi, endj, stari, starj;  /* endpoint and startpoint */
577
578        short orienti, orientj;         /* orientation of segments */
579        short iscon;                            /* containment condition   */
580        int   score;                    /* the max score */
581        int  count, limit;                      /* temporary variables     */
582
583        register  int   i, j, d;                /* row and column indices  */
584        char *my_calloc();                      /* space-allocating function */
585        int  rl, cl;
586        char *A, *B;
587        int  M, N;
588        overptr node1;
589        int  total;                             /* total number of pairs */
590        int  hit;                               /* number of pairs satisfying cond. */
591        int  CHECK();
592
593        v = V;
594        q = Q;
595        r = R;
596        qr = q + r;
597        v1 = V1;
598        r1 = R1;
599        qr1 = q + r1;
600        total = hit = 0;
601        limit = 2 * ( seg_num - 1 );
602        for ( orienti = 0, d = 0; d < limit ; d++ )
603        { 
604                i = d / 2;
605                orienti = 1 - orienti;
606                A = orienti ? segment[i].seq : segment[i].rev;
607                M = segment[i].length;
608                for ( j = i+1; j < seg_num ; j++ )
609                { 
610                        B = segment[j].seq;
611                        orientj = 1;
612                        N = segment[j].length;
613                        total += 1;
614                        if ( CHECK(orienti, i, j) )
615                        { 
616                                hit += 1;
617                                SCORE = 0;
618                                big_pass(A,B,M,N,orienti,orientj);
619                                if ( SCORE )
620                                { 
621                                        score = SCORE;
622                                        stari = ++STARI;
623                                        starj = ++STARJ;
624                                        endi = ENDI;
625                                        endj = ENDJ;
626                                        rl = endi - stari + 1;
627                                        cl = endj - starj + 1;
628                                        sapp = S;
629                                        last = 0;
630                                        al_len = no_mat = no_mis = 0;
631                                        (void) diff(&A[stari]-1, &B[starj]-1,rl,cl,q,q);
632                                        iscon = stari == 1 && endi == M || starj == 1 && endj == N;
633                                        if ( no_mat >= al_len * per_cent &&
634                                            ( al_len >= over_len || iscon ) )
635                                        { 
636                                                node1 = ( overptr ) my_calloc( (int ) sizeof(over));
637                                                if ( iscon )
638                                                        node1->kind = 0;                /* containment */
639                                                else
640                                                { 
641                                                        node1->kind = 1; 
642                                                        edge_num++; 
643                                                }       /* overlap */
644                                                if ( endi == M && ( endj != N || starj != 1 ) ) /*i is 5'*/
645                                                { 
646                                                        node1->number = j;
647                                                        node1->host = i;
648                                                        node1->stari = stari;
649                                                        node1->endi = endi;
650                                                        node1->orienti = orienti;
651                                                        node1->starj = starj;
652                                                        node1->endj = endj;
653                                                        node1->orientj = orientj;
654                                                }
655                                                else    /* j is 5' */
656                                                { 
657                                                        node1->number = i;
658                                                        node1->host = j;
659                                                        node1->stari = starj;
660                                                        node1->endi = endj;
661                                                        node1->orienti = orientj;
662                                                        node1->starj = stari;
663                                                        node1->endj = endi;
664                                                        node1->orientj = orienti;
665                                                }
666                                                node1->score = score;
667                                                node1->length = al_len;
668                                                node1->match = no_mat;
669                                                count = node1->number == i ? j : i;
670                                                node1->next = segment[count].list;
671                                                segment[count].list = node1;
672                                                if ( ! node1->kind )
673                                                        segment[count].kind = 0;
674                                        }
675                                }
676                        }
677                }
678        }
679}
680
681/* Return 1 if two sequences satisfy the necessary condition for overlap,
682   and 0 otherwise. Parameters first and second are the indices of segments,
683   and parameter orient indicates the orientation of segment first.  */
684int  CHECK(orient,first,second) short orient; 
685int  first, second;
686{ 
687        int   limit, bound;             /* maximum number of jumps */
688        int   small;                    /* smaller of limit and bound */
689        float  delta;                   /* cutoff factor   */
690        float cut;                      /* cutoff score */
691        register  int   i;              /* index variable */
692        int  t, q;                      /* temporary variables */
693        int  JUMP();
694        int  RJUMP();
695        int  JUMPC();
696        int  RJUMPC();
697
698        delta = DELTA;
699        if ( orient )
700                limit = JUMP(CC, first, second, 1);
701        else
702                limit = JUMPC(CC, first, second);
703        bound = RJUMP(DD, second, first, orient);
704        small = limit <= bound ? limit : bound;
705        cut = 0;
706        for ( i = 1; i <= small; i++ )
707        { 
708                if ( (t = DD[i] - 1) >= over_len && t >= cut
709                    && (q = CC[i] - 1) >= over_len && q >= cut )
710                        return (1);
711                cut += delta;
712        }
713        if (DD[bound] >= delta*(bound-1) || CC[limit] >= delta*(limit-1))
714                return (1);
715        limit = JUMP(CC, second, first, orient);
716        if ( orient )
717                bound = RJUMP(DD, first, second, 1);
718        else
719                bound = RJUMPC(DD, first, second);
720        small = limit <= bound ? limit : bound;
721        cut = 0;
722        for ( i = 1; i <= small; i++ )
723        { 
724                if ( (t = DD[i] - 1) >= over_len && t >= cut
725                    && (q = CC[i] - 1) >= over_len && q >= cut )
726                        return (1);
727                cut += delta;
728        }
729        return (0);
730}
731
732/* Compute a vector of lengths of jumps */
733int  JUMP(H,one,two,orient) int  H[], one, two; 
734short orient;
735{ 
736        char *A, *B;                    /* pointers to two sequences */
737        int  M, N;                      /* lengths of two sequences */
738        int  *table;                    /* pointer to a lookup table */
739        int  *loc;                      /* pointer to a location table */
740        int  value;                     /* value of a word */
741        int  maxd;                      /* maximum length of an identical diagonal */
742        int  d;                 /* length of current identical diagonal */
743        int  s;                 /* length of jumps */
744        int  k;                 /* number of jumps */
745
746        register int  i, j, p;  /* index variables */
747
748        A = segment[one].seq;
749        M = segment[one].length;
750        table = segment[one].lookup;
751        loc = segment[one].pos;
752        B = orient ? segment[two].seq : segment[two].rev;
753        N = segment[two].length;
754        for ( s = 1, k = 1; s <= N ; k++ )
755        { 
756                maxd = 0;
757                for ( value = -1, d = 0, j = s; d <= tuple && j <= N; j++, d++)
758                { 
759                        if ( vert[B[j]] == 4 ) break;
760                        value = 4 * (value + 1) + vert[B[j]];
761                        if ( ! table[value] ) break;
762                }
763                if ( d > tuple )
764                { 
765                        for ( p = table[value]; p ; p = loc[p] )
766                        { 
767                                d = tuple + 1;
768                                for ( i = p+d, j = s+d; i <= M && j <= N; i++, j++, d++ )
769                                        if ( A[i] != B[j] && vert[A[i]] != 4 && vert[B[j]] != 4 ) break;
770                                if ( maxd < d )
771                                        maxd = d;
772                                if ( j > N ) break;
773                        }
774                }
775                else 
776                        maxd = d;
777                s += maxd + 1;
778                H[k] = s;
779        }
780        return (k - 1);
781}
782
783/* Compute a vector of lengths of jumps for reverse complement of one */
784int  JUMPC(H,one,two) int  H[], one, two;
785{ 
786        char *A, *B;                    /* pointers to two sequences */
787        int  M, N;                      /* lengths of two sequences */
788        int  *table;                    /* pointer to a lookup table */
789        int  *loc;              /* pointer to a location table */
790        int  value;                     /* value of a word */
791        int  maxd;                      /* maximum length of an identical diagonal */
792        int  d;                 /* length of current identical diagonal */
793        int  s;                 /* length of jumps */
794        int  k;                 /* number of jumps */
795
796        register  int   i, j, p;        /* index variables */
797
798        A = segment[one].rev;
799        M = segment[one].length;
800        table = segment[one].lookup;
801        loc = segment[one].pos;
802        B = segment[two].seq;
803        N = segment[two].length;
804        for ( s = 1, k = 1; s <= N ; k++ )
805        { 
806                maxd = 0;
807                for ( value = 0, d = 0, j = s; d <= tuple && j <= N; j++, d++)
808                { 
809                        if ( vert[B[j]] == 4 ) break;
810                        value += vertc[B[j]] * power[d];
811                        if ( ! table[value+base[d]] ) break;
812                }
813                if ( d > tuple )
814                { 
815                        for ( p = table[value+base[tuple]]; p ; p = loc[p] )
816                        { 
817                                d = tuple + 1;
818                                for ( i = M+2-p, j = s+d; i <= M && j <= N; i++, j++, d++ )
819                                        if ( A[i] != B[j] && vert[A[i]] != 4 && vert[B[j]] != 4 ) break;
820                                if ( maxd < d )
821                                        maxd = d;
822                                if ( j > N ) break;
823                        }
824                }
825                else 
826                        maxd = d;
827                s += maxd + 1;
828                H[k] = s;
829        }
830        return (k - 1);
831}
832
833/* Compute a vector of lengths of reverse jumps */
834int  RJUMP(H,one,two,orient) int  H[], one, two; 
835short orient;
836{ 
837        char *A, *B;                    /* pointers to two sequences */
838        int  N;                 /* length of a sequence */
839        int  *table;                    /* pointer to a lookup table */
840        int  *loc;              /* pointer to a location table */
841        int  value;                     /* value of a word */
842        int  maxd;                      /* maximum length of an identical diagonal */
843        int  d;                 /* length of current identical diagonal */
844        int  s;                 /* length of jumps */
845        int  k;                 /* number of jumps */
846
847        register  int   i, j, p;        /* index variables */
848
849        A = segment[one].seq;
850        table = segment[one].lookup;
851        loc = segment[one].pos;
852        B = orient ? segment[two].seq : segment[two].rev;
853        N = segment[two].length;
854        for ( s = 1, k = 1; s <= N ; k++ )
855        { 
856                maxd = 0;
857                for (value = 0, d = 0, j = N+1-s; d <= tuple && j >= 1; j--, d++)
858                { 
859                        if ( vert[B[j]] == 4 ) break;
860                        value += vert[B[j]] * power[d];
861                        if ( ! table[value+base[d]] ) break;
862                }
863                if ( d > tuple )
864                { 
865                        for ( p = table[value+base[tuple]]; p ; p = loc[p] )
866                        { 
867                                d = tuple + 1;
868                                for ( i = p-1, j = N+1-s-d; i >= 1 && j >= 1; i--, j--, d++ )
869                                        if ( A[i] != B[j] && vert[A[i]] != 4 && vert[B[j]] != 4 ) break;
870                                if ( maxd < d )
871                                        maxd = d;
872                                if ( j < 1 ) break;
873                        }
874                }
875                else 
876                        maxd = d;
877                s += maxd + 1;
878                H[k] = s;
879        }
880        return (k - 1);
881}
882
883/* Compute a vector of lengths of reverse jumps for reverse complement */
884int  RJUMPC(H,one,two) int  H[], one, two;
885{ 
886        char *A, *B;                    /* pointers to two sequences */
887        int  M, N;                      /* lengths of two sequences */
888        int  *table;                    /* pointer to a lookup table */
889        int  *loc;              /* pointer to a location table */
890        int  value;                     /* value of a word */
891        int  maxd;                      /* maximum length of an identical diagonal */
892        int  d;                 /* length of current identical diagonal */
893        int  s;                 /* length of jumps */
894        int  k;                 /* number of jumps */
895
896        register  int   i, j, p;        /* index variables */
897
898        A = segment[one].rev;
899        M = segment[one].length;
900        table = segment[one].lookup;
901        loc = segment[one].pos;
902        B = segment[two].seq;
903        N = segment[two].length;
904        for ( s = 1, k = 1; s <= N ; k++ )
905        { 
906                maxd = 0;
907                for (value = -1, d = 0, j = N+1-s; d <= tuple && j >= 1; j--, d++)
908                { 
909                        if ( vert[B[j]] == 4 ) break;
910                        value = 4 * (value + 1) + vertc[B[j]];
911                        if ( ! table[value] ) break;
912                }
913                if ( d > tuple )
914                { 
915                        for ( p = table[value]; p ; p = loc[p] )
916                        { 
917                                d = tuple + 1;
918                                i = M - p - tuple;
919                                for ( j = N-s-tuple; i >= 1 && j >= 1; i--, j--, d++ )
920                                        if ( A[i] != B[j] && vert[A[i]] != 4 && vert[B[j]] != 4 ) break;
921                                if ( maxd < d )
922                                        maxd = d;
923                                if ( j < 1 ) break;
924                        }
925                }
926                else 
927                        maxd = d;
928                s += maxd + 1;
929                H[k] = s;
930        }
931        return (k - 1);
932}
933
934/* Construct contigs */
935ASSEM()
936{ 
937        char *my_calloc();              /* space-allocating function */
938        register  int   i, j, k;        /* index variables */
939        overptr  node1, x, y;           /* temporary pointer */
940        int   five, three;              /* indices of 5' and 3' segments */
941        short   orienti;                /* orientation of 5' segment */
942        short   orientj;                /* orientation of 3' segment */
943        short   sorted;         /* boolean variable */
944
945        contigs = ( struct CONS * ) my_calloc( seg_num * sizeof(struct CONS));
946        for ( i = 0; i < seg_num; i++ )
947        { 
948                contigs[i].isfive[0] = contigs[i].isthree[0] = 1;
949                contigs[i].isfive[1] = contigs[i].isthree[1] = 1;
950                contigs[i].other = i;
951                contigs[i].group = contigs[i].child = -1;
952                contigs[i].brother = contigs[i].father = -1;
953        }
954        for ( i = 0; i < seg_num; i++ )
955                if ( ! segment[i].kind )
956                        for ( ; ; )
957                        { 
958                                for ( y = segment[i].list; y->kind; y = y->next )
959                                        ;
960                                for ( x = y->next; x != 0; x = x->next )
961                                        if ( ! x->kind && x->score > y->score )
962                                                y = x;
963                                for ( j = y->number; (k = contigs[j].father) != -1; j = k )
964                                        ;
965                                if ( j != i )
966                                { 
967                                        contigs[i].father = j = y->number;
968                                        contigs[i].brother = contigs[j].child;
969                                        contigs[j].child = i;
970                                        contigs[i].node[1] = y;
971                                        break;
972                                }
973                                else
974                                { 
975                                        if ( segment[i].list->number == y->number )
976                                                segment[i].list = y->next;
977                                        else
978                                        { 
979                                                for ( x = segment[i].list; x->next->number != y->number ; )
980                                                        x = x->next;
981                                                x->next = y->next;
982                                        }
983                                        for ( x = segment[i].list; x != 0 && x->kind; x = x->next )
984                                                ;
985                                        if ( x == 0 )
986                                        { 
987                                                segment[i].kind = 1;
988                                                break;
989                                        }
990                                }
991                        }
992        edge = ( overptr * ) my_calloc( edge_num * sizeof(overptr) );
993        for ( j = 0, i = 0; i < seg_num; i++ )
994                if ( segment[i].kind )
995                        for ( node1 = segment[i].list; node1 != 0; node1 = node1->next )
996                                if ( segment[node1->number].kind )
997                                        edge[j++] = node1;
998        edge_num = j;
999        for ( i = edge_num - 1; i > 0; i-- )
1000        { 
1001                sorted = 1;
1002                for ( j = 0; j < i; j++ )
1003                        if ( edge[j]->score < edge[j+1]->score )
1004                        { 
1005                                node1 = edge[j];
1006                                edge[j] = edge[j+1];
1007                                edge[j+1] = node1;
1008                                sorted = 0;
1009                        }
1010                if ( sorted )
1011                        break;
1012        }
1013        for ( k = 0; k < edge_num; k++ )
1014        { 
1015                five = edge[k]->host;
1016                three = edge[k]->number;
1017                orienti = edge[k]->orienti;
1018                orientj = edge[k]->orientj;
1019                if ( contigs[five].isthree[orienti] &&
1020                    contigs[three].isfive[orientj] && contigs[five].other != three )
1021                { 
1022                        contigs[five].isthree[orienti] = 0;
1023                        contigs[three].isfive[orientj] = 0;
1024                        contigs[five].next[orienti] = three;
1025                        contigs[five].orient[orienti] = orientj;
1026                        contigs[five].node[orienti] = edge[k];
1027                        contigs[three].isthree[(j = 1 - orientj)] = 0;
1028                        contigs[five].isfive[(i = 1 - orienti)] = 0;
1029                        contigs[three].next[j] = five;
1030                        contigs[three].orient[j] = i;
1031                        contigs[three].node[j] = edge[k];
1032                        i = contigs[three].other;
1033                        j = contigs[five].other;
1034                        contigs[i].other = j;
1035                        contigs[j].other = i;
1036                }
1037        }
1038}
1039
1040REPAIR()
1041{ 
1042        int  endi, endj, stari, starj;  /* endpoint and startpoint */
1043
1044        short orienti, orientj;         /* orientation of segments */
1045        short isconi, isconj;                   /* containment condition   */
1046        int   score;                    /* the max score */
1047        int   i, j, f, d, e;                    /* row and column indices  */
1048        char *my_calloc();                      /* space-allocating function */
1049        char *A, *B;
1050        int  M, N;
1051        overptr node1;
1052        int   piece_num;                /* The number of pieces */
1053        int   count, limit;
1054        int   number;
1055        int   hit;
1056
1057        piece = ( struct VX * ) my_calloc( seg_num * sizeof(struct VX));
1058        for ( j = 0, i = 0; i < seg_num; i++ )
1059                if (segment[i].kind && (contigs[i].isfive[1] || contigs[i].isfive[0]))
1060                        piece[j++].id = i;
1061        piece_num = j;
1062        for ( i = 0; i < piece_num; i++ )
1063        { 
1064                piece[i].kind = 1;
1065                piece[i].list = 0;
1066        }
1067        limit = 2 * ( piece_num - 1 );
1068        hit = number = 0;
1069        for ( orienti = 0, d = 0; d < limit ; d++ )
1070        { 
1071                i = piece[(e = d / 2)].id;
1072                orienti = 1 - orienti;
1073                A = orienti ? segment[i].seq : segment[i].rev;
1074                M = segment[i].length;
1075                for ( f = e+1; f < piece_num ; f++ )
1076                { 
1077                        j = piece[f].id;
1078                        B = segment[j].seq;
1079                        orientj = 1;
1080                        N = segment[j].length;
1081                        SCORE = 0;
1082                        hit++;
1083                        big_pass(A,B,M,N,orienti,orientj);
1084                        if ( SCORE > CUTOFF )
1085                        { 
1086                                score = SCORE;
1087                                stari = ++STARI;
1088                                starj = ++STARJ;
1089                                endi = ENDI;
1090                                endj = ENDJ;
1091                                isconi = stari == 1 && endi == M;
1092                                isconj = starj == 1 && endj == N;
1093                                node1 = ( overptr ) my_calloc( (int ) sizeof(over));
1094                                if ( isconi || isconj )
1095                                        node1->kind = 0;                /* containment */
1096                                else
1097                                { 
1098                                        node1->kind = 1; 
1099                                        number++; 
1100                                }       /* overlap */
1101                                if ( endi == M && ! isconj )     /*i is 5'*/
1102                                { 
1103                                        node1->number = j;
1104                                        node1->host = i;
1105                                        node1->ind = f;
1106                                        node1->stari = stari;
1107                                        node1->endi = endi;
1108                                        node1->orienti = orienti;
1109                                        node1->starj = starj;
1110                                        node1->endj = endj;
1111                                        node1->orientj = orientj;
1112                                }
1113                                else    /* j is 5' */
1114                                { 
1115                                        node1->number = i;
1116                                        node1->host = j;
1117                                        node1->ind = e;
1118                                        node1->stari = starj;
1119                                        node1->endi = endj;
1120                                        node1->orienti = orientj;
1121                                        node1->starj = stari;
1122                                        node1->endj = endi;
1123                                        node1->orientj = orienti;
1124                                }
1125                                node1->score = score;
1126                                count = node1->number == i ? f : e;
1127                                node1->next = piece[count].list;
1128                                piece[count].list = node1;
1129                                if ( ! node1->kind )
1130                                        piece[count].kind = 0;
1131                        }
1132                }
1133        }
1134        REASSEM(piece_num, number);
1135}
1136
1137/* Construct contigs */
1138REASSEM(piece_num, number) int  piece_num, number;
1139{ 
1140        char *my_calloc();              /* space-allocating function */
1141        int   i, j, k, d;               /* index variables */
1142        overptr  node1, x, y;           /* temporary pointer */
1143        int   five, three;              /* indices of 5' and 3' segments */
1144        short   orienti;                /* orientation of 5' segment */
1145        short   orientj;                /* orientation of 3' segment */
1146        short   sorted;         /* boolean variable */
1147
1148        for ( d = 0; d < piece_num; d++ )
1149                if ( ! piece[d].kind )
1150                        for ( i = piece[d].id ; ; )
1151                        { 
1152                                for ( y = piece[d].list; y->kind; y = y->next )
1153                                        ;
1154                                for ( x = y->next; x != 0; x = x->next )
1155                                        if ( ! x->kind && x->score > y->score )
1156                                                y = x;
1157                                for ( j = y->number; (k = contigs[j].father) != -1; j = k )
1158                                        ;
1159                                if ( j != i && RECONCILE(y,&piece_num,&number) )
1160                                { 
1161                                        contigs[i].father = j = y->number;
1162                                        contigs[i].brother = contigs[j].child;
1163                                        contigs[j].child = i;
1164                                        contigs[i].node[1] = y;
1165                                        segment[i].kind = 0;
1166                                        break;
1167                                }
1168                                else
1169                                { 
1170                                        if ( piece[d].list->number == y->number )
1171                                                piece[d].list = y->next;
1172                                        else
1173                                        { 
1174                                                for ( x = piece[d].list; x->next->number != y->number ; )
1175                                                        x = x->next;
1176                                                x->next = y->next;
1177                                        }
1178                                        for ( x = piece[d].list; x != 0 && x->kind; x = x->next )
1179                                                ;
1180                                        if ( x == 0 )
1181                                        { 
1182                                                piece[d].kind = 1;
1183                                                break;
1184                                        }
1185                                }
1186                        }
1187        if ( number > edge_num )
1188                edge = ( overptr * ) my_calloc( number * sizeof(overptr) );
1189        for ( j = 0, d = 0; d < piece_num; d++ )
1190                if ( piece[d].kind )
1191                        for ( node1 = piece[d].list; node1 != 0; node1 = node1->next )
1192                                if ( piece[node1->ind].kind )
1193                                        edge[j++] = node1;
1194        edge_num = j;
1195        for ( i = edge_num - 1; i > 0; i-- )
1196        { 
1197                sorted = 1;
1198                for ( j = 0; j < i; j++ )
1199                        if ( edge[j]->score < edge[j+1]->score )
1200                        { 
1201                                node1 = edge[j];
1202                                edge[j] = edge[j+1];
1203                                edge[j+1] = node1;
1204                                sorted = 0;
1205                        }
1206                if ( sorted )
1207                        break;
1208        }
1209        for ( k = 0; k < edge_num; k++ )
1210        { 
1211                five = edge[k]->host;
1212                three = edge[k]->number;
1213                orienti = edge[k]->orienti;
1214                orientj = edge[k]->orientj;
1215                if ( contigs[five].isthree[orienti] &&
1216                    contigs[three].isfive[orientj] && contigs[five].other != three )
1217                { 
1218                        contigs[five].isthree[orienti] = 0;
1219                        contigs[three].isfive[orientj] = 0;
1220                        contigs[five].next[orienti] = three;
1221                        contigs[five].orient[orienti] = orientj;
1222                        contigs[five].node[orienti] = edge[k];
1223                        contigs[three].isthree[(j = 1 - orientj)] = 0;
1224                        contigs[five].isfive[(i = 1 - orienti)] = 0;
1225                        contigs[three].next[j] = five;
1226                        contigs[three].orient[j] = i;
1227                        contigs[three].node[j] = edge[k];
1228                        i = contigs[three].other;
1229                        j = contigs[five].other;
1230                        contigs[i].other = j;
1231                        contigs[j].other = i;
1232                }
1233        }
1234}
1235
1236RECONCILE(y, pp,nn) overptr y; 
1237int  *pp,*nn;
1238{ 
1239        short orienti, orientj;         /* orientation of segments */
1240        short orientk, orientd;         /* orientation of segments */
1241        int   i, j, k, d, f;                    /* row and column indices  */
1242        char *my_calloc();                      /* space-allocating function */
1243        char *A, *B;
1244        int  M, N;
1245        overptr node1;
1246
1247        k = y->host;
1248        d = y->number;
1249        orientk = y->orienti;
1250        orientd = y->orientj;
1251        if ( ! contigs[k].isthree[orientk] )
1252        { 
1253                if ( ! piece[y->ind].kind ) return (0);
1254                if ( contigs[d].isthree[orientd] )
1255                { 
1256                        orienti = orientd;
1257                        i = d;
1258                        orientj = contigs[k].orient[orientk];
1259                        j = contigs[k].next[orientk];
1260                }
1261                else
1262                        return (0);
1263        }
1264        else
1265                if ( ! contigs[k].isfive[orientk] )
1266                { 
1267                        if ( ! piece[y->ind].kind ) return (0);
1268                        if ( contigs[d].isfive[orientd] )
1269                        { 
1270                                orienti = contigs[k].orient[1-orientk];
1271                                orienti = 1 - orienti;
1272                                i = contigs[k].next[1-orientk];
1273                                orientj = orientd;
1274                                j = d;
1275                        }
1276                        else
1277                                return (0);
1278                }
1279                else
1280                        return (0);
1281        A = orienti ? segment[i].seq : segment[i].rev;
1282        M = segment[i].length;
1283        B = orientj ? segment[j].seq : segment[j].rev;
1284        N = segment[j].length;
1285        SCORE = 0;
1286        big_pass(A,B,M,N,orienti,orientj);
1287        if ( SCORE > CUTOFF && ENDI - STARI > over_len && ENDI == M && STARJ == 0 )
1288        { 
1289                node1 = ( overptr ) my_calloc( (int ) sizeof(over));
1290                node1->kind = 1;
1291                node1->host = i;
1292                node1->number = j;
1293                node1->stari = ++STARI;
1294                node1->endi = ENDI;
1295                node1->orienti = orienti;
1296                node1->starj = ++STARJ;
1297                node1->endj = ENDJ;
1298                node1->orientj = orientj;
1299                node1->score = SCORE;
1300                piece[*pp].kind = 1;
1301                if ( i == d )
1302                { 
1303                        node1->ind = *pp;
1304                        node1->next = piece[y->ind].list;
1305                        piece[y->ind].list = node1;
1306                        piece[*pp].id = j;
1307                        piece[*pp].list = 0;
1308                }
1309                else
1310                { 
1311                        node1->ind = y->ind;
1312                        piece[*pp].list = node1;
1313                        node1->next = 0;
1314                        piece[*pp].id = i;
1315                }
1316                (*nn)++;
1317                (*pp)++;
1318                f = contigs[k].other;
1319                if ( ! contigs[k].isthree[orientk] )
1320                { 
1321                        contigs[j].isfive[orientj] = 1;
1322                        contigs[j].isthree[1 - orientj] = 1;
1323                        contigs[k].isthree[orientk] = 1;
1324                        contigs[k].isfive[1 - orientk] = 1;
1325                        contigs[f].other = j;
1326                        contigs[j].other = f;
1327                }
1328                else
1329                { 
1330                        contigs[i].isthree[orienti] = 1;
1331                        contigs[i].isfive[1 - orienti] = 1;
1332                        contigs[k].isfive[orientk] = 1;
1333                        contigs[k].isthree[1 - orientk] = 1;
1334                        contigs[f].other = i;
1335                        contigs[i].other = f;
1336                }
1337                contigs[k].other = k;
1338                return (1);
1339        }
1340        return (0);
1341}
1342
1343/* Construct a tree of overlapping-containment segments */
1344FORM_TREE()
1345{ 
1346        register  int   i, j, k;        /* index variables */
1347        char *my_calloc();              /* space-allocating function */
1348        overptr  node1;         /* temporary pointer */
1349        short   orient;         /* orientation of segment */
1350        int   group;                    /* serial number of contigs  */
1351        char *A, *B;                    /* pointers to segment sequences */
1352        int  stari, endi, starj, endj;/* positions where alignment begins */
1353        int  M, N;                      /* lengths of segment sequences */
1354        int   count;                    /* temporary variables */
1355
1356        mtree = ( struct TTREE * ) my_calloc( seg_num * sizeof(struct TTREE));
1357        for ( i = 0; i < seg_num; i++ )
1358        { 
1359                mtree[i].head = 0;
1360                mtree[i].next = mtree[i].child = mtree[i].brother = -1;
1361        }
1362        for ( group = 0, i = 0; i < seg_num; i++ )
1363                if ( segment[i].kind && contigs[i].group < 0 &&
1364                    ( contigs[i].isfive[1] || contigs[i].isfive[0] ) )
1365                { 
1366                        orient = contigs[i].isfive[1] ? 1 : 0;
1367                        mtree[i].head = 1;
1368                        for ( j = i; ;  )
1369                        { 
1370                                contigs[j].group = group;
1371                                mtree[j].orient = orient;
1372                                SORT(j, orient);
1373                                if ( contigs[j].isthree[orient] )
1374                                        break;
1375                                else
1376                                { 
1377                                        k = contigs[j].next[orient];
1378                                        node1 = contigs[j].node[orient];
1379                                        if ( j == node1->host )
1380                                        { 
1381                                                stari = node1->stari;
1382                                                endi  = node1->endi;
1383                                                starj = node1->starj;
1384                                                endj  = node1->endj;
1385                                                A = node1->orienti ? segment[j].seq : segment[j].rev;
1386                                                B = node1->orientj ? segment[k].seq : segment[k].rev;
1387                                        }
1388                                        else
1389                                        { 
1390                                                M = segment[j].length;
1391                                                stari = M + 1 - node1->endj;
1392                                                endi = M + 1 - node1->starj;
1393                                                N = segment[k].length;
1394                                                starj = N + 1 - node1->endi;
1395                                                endj = N + 1 - node1->stari;
1396                                                A = node1->orientj ? segment[j].rev : segment[j].seq;
1397                                                B = node1->orienti ? segment[k].rev : segment[k].seq;
1398                                        }
1399                                        M = endi - stari + 1;
1400                                        N = endj - starj + 1;
1401                                        sapp = S;
1402                                        last = 0;
1403                                        al_len = no_mat = no_mis = 0;
1404                                        (void) diff(&A[stari]-1, &B[starj]-1,M,N,q,q);
1405                                        count = ( (N = sapp - S) + 1 ) * sizeof(int );
1406                                        mtree[k].script = ( int  * ) my_calloc( count );
1407                                        for ( M = 0; M < N; M++)
1408                                                mtree[k].script[M] = S[M];
1409                                        mtree[k].size = N;
1410                                        mtree[k].begin = stari;
1411                                        mtree[j].next = k;
1412                                        orient = contigs[j].orient[orient];
1413                                        j = k;
1414                                }
1415                        }
1416                        group++;
1417                }
1418}
1419
1420/* Sort the children of each node by the `begin' field */
1421SORT(seg, ort) int  seg; 
1422short ort;
1423{ 
1424        register  int   i, j, k;        /* index variables */
1425        char *my_calloc();              /* space-allocating function */
1426        overptr  node1;         /* temporary pointer */
1427        short   orient;         /* orientation of segment */
1428        char *A, *B;                    /* pointers to segment sequences */
1429        int  stari, endi, starj, endj;/* positions where alignment begins */
1430        int  M, N;                      /* lengths of segment sequences */
1431        int   count;                    /* temporary variables */
1432
1433        for ( j = contigs[seg].child; j != -1; j = contigs[j].brother )
1434        { 
1435                node1 = contigs[j].node[1];
1436                if ( ort == node1->orientj )
1437                { 
1438                        stari = node1->starj;
1439                        endi  = node1->endj;
1440                        starj = node1->stari;
1441                        endj  = node1->endi;
1442                        A = node1->orientj ? segment[seg].seq : segment[seg].rev;
1443                        B = node1->orienti ? segment[j].seq : segment[j].rev;
1444                        orient = node1->orienti;
1445                }
1446                else
1447                { 
1448                        M = segment[seg].length;
1449                        stari = M + 1 - node1->endj;
1450                        endi = M + 1 - node1->starj;
1451                        N = segment[j].length;
1452                        starj = N + 1 - node1->endi;
1453                        endj = N + 1 - node1->stari;
1454                        A = node1->orientj ? segment[seg].rev : segment[seg].seq;
1455                        B = node1->orienti ? segment[j].rev : segment[j].seq;
1456                        orient = 1 -  node1->orienti;
1457                }
1458                M = endi - stari + 1;
1459                N = endj - starj + 1;
1460                sapp = S;
1461                last = 0;
1462                al_len = no_mat = no_mis = 0;
1463                (void) diff(&A[stari]-1, &B[starj]-1,M,N,q,q);
1464                count = ( (M = sapp - S ) + 1 ) * sizeof(int );
1465                mtree[j].script = ( int  * ) my_calloc( count );
1466                for ( k = 0; k < M; k++)
1467                        mtree[j].script[k] = S[k];
1468                mtree[j].size = M;
1469                mtree[j].begin = stari;
1470                mtree[j].orient = orient;
1471                if ( mtree[seg].child == -1 )
1472                        mtree[seg].child = j;
1473                else
1474                { 
1475                        i = mtree[seg].child;
1476                        if ( mtree[i].begin >= stari )
1477                        { 
1478                                mtree[j].brother = i;
1479                                mtree[seg].child = j;
1480                        }
1481                        else
1482                        { 
1483                                M = mtree[i].brother;
1484                                for ( ; M != -1; i = M, M = mtree[M].brother )
1485                                        if ( mtree[M].begin >= stari ) break;
1486                                mtree[j].brother = M;
1487                                mtree[i].brother = j;
1488                        }
1489                }
1490                SORT(j, orient);
1491        }
1492}
1493
1494/* Display the alignments of segments */
1495SHOW()
1496{ 
1497        register  int   i, j, k;        /* index variables */
1498        char *my_calloc();              /* space-allocating function */
1499        int   n;                        /* number of working segments */
1500        int   limit;                    /* number of slots in work */
1501        int   col;                      /* number of output columns prepared */
1502        short done;                     /* tells if current group is done */
1503        rowptr root;                    /* pointer to root of op tree */
1504        int   sym[6];                   /* occurrance counts for six chars */
1505        char  c;                        /* temp variable */
1506        rowptr t, w, yy;                /* temp pointer */
1507        int    x;                       /* temp variables */
1508        int   group;                    /* Contigs number */
1509        char  conlit[20], *a;           /* String form of contig number */
1510        char  *spt;                     /* pointer to the start of consensus */
1511
1512        work = ( rowptr * ) my_calloc( seg_num * sizeof(rowptr));
1513        group = 0;
1514        yy = 0;
1515        for ( j = 0; j < 6; j++ )
1516                sym[j] = 0;
1517        n = limit = col = 0;
1518        for ( i = 0; i < seg_num; i++ )
1519                if ( mtree[i].head )
1520                { 
1521                        (void) sprintf(conlit, ">Contig %d\n", group);
1522                        for ( a = conlit; *a; )
1523                                *allconpt++ = *a++;
1524                        /* Mod by S.S.
1525     (void) printf("\n#Contig %d\n\n", group++);
1526*/
1527                        group++;
1528                        done = 0;
1529                        ENTER(&limit, &n, i, col, yy);
1530                        root = work[0];
1531                        spt = allconpt;
1532                        while ( ! done )
1533                        { 
1534                                for ( j = 0; j < n; j++ )       /* get segments into work */
1535                                { 
1536                                        t = work[j];
1537                                        k = t->id;
1538                                        if ((x = mtree[k].next) != -1 && mtree[x].begin == t->loc)
1539                                        { 
1540                                                ENTER(&limit, &n, x, col, t);
1541                                                mtree[k].next = -1;
1542                                        }
1543                                        for ( x = mtree[k].child; x != -1; x = mtree[x].brother )
1544                                                if ( mtree[x].begin == t->loc )
1545                                                { 
1546                                                        ENTER(&limit, &n, x, col, t);
1547                                                        mtree[k].child = mtree[x].brother;
1548                                                }
1549                                                else
1550                                                        break;
1551                                }
1552                                COLUMN(root);           /* determine next column */
1553                                root->c = root->kind;
1554                                for ( t = head; t != 0; t = t->link )
1555                                        t->c = t->kind;
1556                                for ( j = 0; j < n; j++ )
1557                                { 
1558                                        t = work[j];
1559                                        if ( t->done )
1560                                                *t->a++ = ' ';
1561                                        else
1562                                        { 
1563                                                if ( t->c == 'L' )
1564                                                { 
1565                                                        if ( t->loc == 1 )
1566                                                                t->offset = allconpt - spt;
1567                                                        c = *t->a++ = t->seq[t->loc++];
1568                                                }
1569                                                else
1570                                                        if ( t->loc > 1 )
1571                                                                c = *t->a++ = '-';
1572                                                        else
1573                                                                c = *t->a++ = ' ';
1574                                                if ( c != ' ' )
1575                                                        if ( c == '-' )
1576                                                                sym[5] += 1;
1577                                                        else
1578                                                                sym[vert[c]] += 1;
1579                                                t->c = ' ';
1580                                        }
1581                                }
1582                                /* determine consensus char */
1583                                k = sym[0] + sym[1] + sym[2] + sym[3] + sym[4];
1584                                if ( k < sym[5] )
1585                                        *allconpt++ = '-';
1586                                else
1587                                        if ( sym[0] == sym[1] && sym[1] == sym[2] &&
1588                                            sym[2] == sym[3] )
1589                                                *allconpt++ = 'N';
1590                                        else
1591                                        { 
1592                                                k = sym[0];
1593                                                c = 'A';
1594                                                if ( k < sym[1] ) { 
1595                                                        k = sym[1]; 
1596                                                        c = 'C'; 
1597                                                }
1598                                                if ( k < sym[2] ) { 
1599                                                        k = sym[2]; 
1600                                                        c = 'G'; 
1601                                                }
1602                                                if ( k < sym[3] ) c = 'T';
1603                                                *allconpt++ = c;
1604                                        }
1605                                for ( j = 0; j < 6; j++ )
1606                                        sym[j] = 0;
1607                                for ( t = head; t != 0; t = t->link )
1608                                { 
1609                                        NEXTOP(t);
1610                                        if ( t->done )  /* delete it from op tree */
1611                                        { 
1612                                                w = t->father;
1613                                                if ( w->child->id == t->id )
1614                                                        w->child = t->brother;
1615                                                else
1616                                                { 
1617                                                        w = w->child;
1618                                                        for ( ; w->brother->id != t->id; w = w->brother )
1619                                                                ;
1620                                                        w->brother = t->brother;
1621                                                }
1622                                        }
1623                                }
1624                                if ( root->loc > root->length ) /* check root node */
1625                                { 
1626                                        root->done = 1;
1627                                        if ( (w = root->child) != 0 )
1628                                        { 
1629                                                w->father = 0;
1630                                                root = w;
1631                                        }
1632                                        else
1633                                                done = 1;
1634                                }
1635                                col++;
1636                                if ( col == LINELEN || done )   /* output */
1637                                { 
1638                                        col = 0;
1639                                        for ( j = 0; j < n; j++ )
1640                                        { 
1641                                                t = work[j];
1642                                                if ( t->done )
1643                                                /*
1644                Mod by S.S.
1645                      { (void) printf("#");
1646                        for ( a = t->name; *a; a++ )
1647                          (void) printf("%c", *a);
1648*/
1649                                                {
1650                                                        int jj;
1651                                                        (void) printf("{\nname  ");
1652                                                        for(jj=0;jj<strlen(t->name)-1;jj++)
1653                                                                (void) printf("%c", t->name[jj]);
1654                                                        printf("\nstrandedness  %c\n",
1655                                                                t->name[strlen(t->name)] == '+'? '1':'2');
1656
1657                                                        printf("offset  %d\ntype  DNA\ngroup-ID %d\nsequence    \"\n",
1658                                                            t->offset,group);
1659                                                        for ( k = 0, a = t->line ; a != t->a; a++ )
1660                                                                if ( *a != ' ' )
1661                                                                { 
1662                                                                        k++;
1663                                                                        (void)  printf("%c", *a);
1664                                                                        if ( k == LINELEN )
1665                                                                        { 
1666                                                                                (void)  printf("\n");
1667                                                                                k = 0;
1668                                                                        }
1669                                                                }
1670/*
1671                        if ( k )
1672*/
1673                                                        (void)  printf("\"\n}\n");
1674                                                }
1675                                                if ( t->linesize - (t->a - t->line) < LINELEN + 3 )
1676                                                        ALOC_SEQ(t);
1677                                        }
1678                                        if ( !done )
1679                                        { 
1680                                                for ( k = j = n - 1; j >= 0; j-- )
1681                                                        if ( work[j]->done )
1682                                                        { 
1683                                                                t = work[j];
1684                                                                for ( x = j; x < k; x++ )
1685                                                                        work[x] = work[x+1];
1686                                                                work[k--] = t;
1687                                                        }
1688                                                n = k + 1;
1689                                        }
1690                                        else
1691                                                n = 0;
1692                                }
1693                        }
1694                }
1695}
1696
1697/* allocate more space for output fragment */
1698ALOC_SEQ(t) rowptr t;
1699{ 
1700        char *my_calloc();              /* space-allocating function */
1701        char  *start, *end, *p;
1702        t->linesize *= 2;
1703        start = t->line;
1704        end = t->a;
1705        t->line = ( char * ) my_calloc( t->linesize * sizeof(char));
1706        for ( t->a = t->line, p  = start ; p != end; )
1707                *t->a++ = *p++;
1708        free(start);
1709        return 0;
1710}
1711
1712/* enter a segment into working set */
1713ENTER(b, d, id, pos, par) int  *b, *d, id, pos; 
1714rowptr par;
1715{ 
1716        int  i;
1717        char *my_calloc();              /* space-allocating function */
1718        rowptr  t;
1719
1720        if ( *b <= *d )
1721        { 
1722                work[*b] = ( rowptr ) my_calloc( (int ) sizeof(row));
1723                work[*b]->line = ( char * ) my_calloc( SEQLEN * sizeof(char));
1724                work[*b]->linesize = SEQLEN;
1725                *b += 1;
1726        }
1727        t = work[*d];
1728        *d += 1;
1729        t->a = t->line;
1730        for ( i = 0; i < pos; i++ )
1731                *t->a++ = ' ';
1732        t->c = ' ';
1733        t->seq = mtree[id].orient ? segment[id].seq : segment[id].rev;
1734        t->length = segment[id].length;
1735        t->id = id;
1736        if ( par != 0 )
1737        { 
1738                t->s = mtree[id].script;
1739                t->size = mtree[id].size;
1740        }
1741        t->op = 0;
1742        for ( i = 1; i <= segment[id].len && i <= NAMELEN; i++ )
1743                t->name[i-1] = segment[id].name[i];
1744        if ( mtree[id].orient )
1745                t->name[i-1] = '+';
1746        else
1747                t->name[i-1] = '-';
1748        t->name[i] = '\0';
1749        t->done = 0;
1750        t->loc = 1;
1751        t->child = 0;
1752        t->father = par;
1753        if ( par != 0 )
1754        { 
1755                t->brother = par->child;
1756                par->child = t;
1757                NEXTOP(t);
1758        }
1759}
1760
1761/* get the next operation */
1762NEXTOP(t) rowptr  t;
1763{       
1764        if ( t->size || t->op )
1765                if ( t->op == 0 && *t->s == 0 )
1766                { 
1767                        t->op = *t->s++;
1768                        t->size--;
1769                        t->up = 'L';
1770                        t->dw = 'L';
1771                }
1772                else
1773                { 
1774                        if ( t->op == 0 )
1775                        { 
1776                                t->op = *t->s++;
1777                                t->size--;
1778                        }
1779                        if ( t->op > 0 )
1780                        { 
1781                                t->up = '-';
1782                                t->dw = 'L';
1783                                t->op--;
1784                        }
1785                        else
1786                        { 
1787                                t->up = 'L';
1788                                t->dw = '-';
1789                                t->op++;
1790                        }
1791                }
1792        else
1793                if ( t->loc > t->length )
1794                        t->done = 1;
1795}
1796
1797COLUMN(x) rowptr x;
1798{ 
1799        rowptr  y;
1800        rowptr  start, end;             /* first and last nodes for subtree */
1801
1802        if ( x->child == 0 )
1803        { 
1804                head = tail = 0;
1805                x->kind = 'L';
1806        }
1807        else
1808        { 
1809                start = end = 0;
1810                x->kind = 'L';
1811                for ( y = x->child; y != 0; y = y->brother )
1812                { 
1813                        COLUMN(y);
1814                        if ( x->kind == y->up )
1815                                if ( y->kind == y->dw )
1816                                { 
1817                                        if ( head == 0 )
1818                                        { 
1819                                                y->link = 0;
1820                                                head = tail = y;
1821                                        }
1822                                        else
1823                                        { 
1824                                                y->link = head;
1825                                                head = y;
1826                                        }
1827                                        if ( end == 0 )
1828                                                start = head;
1829                                        else
1830                                                end->link = head;
1831                                        end = tail;
1832                                }
1833                                else
1834                                        if ( y->kind == '-' )
1835                                        { 
1836                                                start = head;
1837                                                end = tail;
1838                                                x->kind = '-';
1839                                        }
1840                                        else
1841                                        { 
1842                                                y->link = 0;
1843                                                y->kind = '-';
1844                                                if ( end == 0 )
1845                                                        start = end = y;
1846                                                else
1847                                                { 
1848                                                        end->link = y;
1849                                                        end = y;
1850                                                }
1851                                        }
1852                        else
1853                                if ( y->kind == y->dw )
1854                                        if ( x->kind == '-' )
1855                                                ;
1856                                        else
1857                                        { 
1858                                                if ( head == 0 )
1859                                                { 
1860                                                        y->link = 0;
1861                                                        head = tail = y;
1862                                                }
1863                                                else
1864                                                { 
1865                                                        y->link = head;
1866                                                        head = y;
1867                                                }
1868                                                start = head;
1869                                                end = tail;
1870                                                x->kind = '-';
1871                                        }
1872                                else
1873                                        if ( x->kind == '-' )
1874                                                if ( y->kind == '-' )
1875                                                { 
1876                                                        if ( end == 0 )
1877                                                        { 
1878                                                                start = head;
1879                                                                end = tail;
1880                                                        }
1881                                                        else
1882                                                                if ( head == 0 )
1883/* code folded from here */
1884        ;
1885/* unfolding */
1886                                                                else
1887                                                                { 
1888/* code folded from here */
1889        end->link = head;
1890        end = tail;
1891/* unfolding */
1892                                                                }
1893                                                }
1894                                                else
1895                                                        ;
1896                                        else
1897                                        { 
1898                                                start = head;
1899                                                end = tail;
1900                                                x->kind = '-';
1901                                        }
1902                }
1903                head = start;
1904                tail = end;
1905        }
1906}
1907
1908/* Display a summary of contigs */
1909GRAPH()
1910{ 
1911        int   i, j, k;          /* index variables */
1912        int   group;                    /* serial number of contigs  */
1913        char name[NAMELEN+2];           /* name of segment */
1914        char  *t;                       /* temp var */
1915        int   length;                   /* length of name */
1916
1917        (void)  printf("\nOVERLAPS            CONTAINMENTS\n\n");
1918        group = 1;
1919        for ( i = 0; i < seg_num; i++ )
1920                if ( mtree[i].head )
1921                { 
1922                        (void) printf("******************* Contig %d ********************\n",
1923                            group++ );
1924                        for ( j = i; j != -1; j = mtree[j].next )
1925                        { 
1926                                length = segment[j].len;
1927                                t = segment[j].name + 1;
1928                                for ( k = 0; k < length && k < NAMELEN; k++ )
1929                                        name[k] = *t++;
1930                                if ( mtree[j].orient )
1931                                        name[k] = '+';
1932                                else
1933                                        name[k] = '-';
1934                                name[k+1] = '\0';
1935                                (void) printf("%s\n", name);
1936                                CONTAIN(mtree[j].child, name);
1937                        }
1938                }
1939}
1940
1941CONTAIN(id, f) int  id; 
1942char *f;
1943{ 
1944        int   k;                        /* index variable */
1945        char name[NAMELEN+2];           /* name of segment */
1946        char  *t;                       /* temp var */
1947        int   length;                   /* length of name */
1948
1949        if ( id != -1 )
1950        { 
1951                length = segment[id].len;
1952                t = segment[id].name + 1;
1953                for ( k = 0; k < length && k < NAMELEN; k++ )
1954                        name[k] = *t++;
1955                if ( mtree[id].orient )
1956                        name[k] = '+';
1957                else
1958                        name[k] = '-';
1959                name[k+1] = '\0';
1960                (void) printf("                    %s is in %s\n", name,f);
1961                CONTAIN(mtree[id].child, name);
1962                CONTAIN(mtree[id].brother, f);
1963        }
1964}
1965
1966big_pass(A,B,M,N,orienti,orientj) char A[],B[]; 
1967int  M,N; 
1968short orienti, orientj;
1969{ 
1970        register  int   i, j;                   /* row and column indices */
1971        register  int   c;                      /* best score at current point */
1972        register  int   f;                      /* best score ending with insertion */
1973        register  int   d;                      /* best score ending with deletion */
1974        register  int   p;                      /* best score at (i-1, j-1) */
1975        register  int   ci;                     /* end-point associated with c */
1976
1977        register  int   di;                     /* end-point associated with d */
1978        register  int   fi;                     /* end-point associated with f */
1979        register  int   pi;                     /* end-point associated with p */
1980        int   *va;                              /* pointer to v(A[i], B[j]) */
1981        int   x1, x2;           /* regions of A before x1 or after x2 are lightly penalized */
1982        int   y1, y2;           /* regions of B before y1 or after y2 are lightly penalized */
1983        short  heavy;           /* 1 = heavy penalty */
1984        int   ex, gx;           /* current gap penalty scores */
1985
1986        /* determine x1, x2, y1, y2 */
1987        if ( POS5 >= POS3 )
1988                fatal("The value for POS5 must be less than the value for POS3");
1989        if ( orienti )
1990        { 
1991                x1 = POS5 >= M ? 1 : POS5;
1992                x2 = POS3 >= M ? M : POS3;
1993        }
1994        else
1995        { 
1996                x1 = POS3 >= M ? 1 : M - POS3 + 1;
1997                x2 = POS5 >= M ? M : M - POS5 + 1;
1998        }
1999        if ( orientj )
2000        { 
2001                y1 = POS5 >= N ? 1 : POS5;
2002                y2 = POS3 >= N ? N : POS3;
2003        }
2004        else
2005        { 
2006                y1 = POS3 >= N ? 1 : N - POS3 + 1;
2007                y2 = POS5 >= N ? N : N - POS5 + 1;
2008        }
2009        if ( x1 + 1 <= x2 ) x1++;
2010        if ( y1 + 1 <= y2 ) y1++;
2011        heavy = 0;
2012
2013        /* Compute the matrix.
2014           CC : the scores of the current row
2015           RR : the starting point that leads to score CC
2016           DD : the scores of the current row, ending with deletion
2017           SS : the starting point that leads to score DD        */
2018        /* Initialize the 0 th row */
2019        for ( j = 1; j <= N ; j++ )
2020        { 
2021                CC[j] = 0;
2022                DD[j] = - (q);
2023                RR[j] = SS[j] = -j;
2024        }
2025        for ( i = 1; i <= M; i++)
2026        { 
2027                if ( i == x1 ) heavy = 1 - heavy;
2028                if ( i == x2 ) heavy = 1 - heavy;
2029                ex = r1;
2030                gx = qr1;
2031                va = v1[A[i]];
2032                c = 0;                          /* Initialize column 0 */
2033                f = - (q);
2034                ci = fi = i;
2035                p = 0;
2036                pi = i - 1;
2037                for ( j = 1 ; j <= N ; j++ )
2038                { 
2039                        if ( j == y1 )
2040                        { 
2041                                if ( heavy )
2042                                { 
2043                                        ex = r;
2044                                        gx = qr;
2045                                        /*
2046S.S.
2047                        va = v[A[i]];
2048*/
2049                                        va = v[A[i]];
2050                                }
2051                        }
2052                        if ( j == y2 )
2053                        { 
2054                                if ( heavy )
2055                                { 
2056                                        ex = r1;
2057                                        gx = qr1;
2058                                        va = v1[A[i]];
2059                                }
2060                        }
2061                        if ( ( f = f - ex ) < ( c = c - gx ) )
2062                        { 
2063                                f = c; 
2064                                fi = ci; 
2065                        }
2066                        di = SS[j];
2067                        if ( ( d = DD[j] - ex ) < ( c = CC[j] - gx ) )
2068                        { 
2069                                d = c; 
2070                                di = RR[j]; 
2071                        }
2072                        c = p+va[B[j]];         /* diagonal */
2073                        ci = pi;
2074                        if ( c < d )
2075                        { 
2076                                c = d; 
2077                                ci = di; 
2078                        }
2079                        if ( c < f )
2080                        { 
2081                                c = f; 
2082                                ci = fi; 
2083                        }
2084                        p = CC[j];
2085                        CC[j] = c;
2086                        pi = RR[j];
2087                        RR[j] = ci;
2088                        DD[j] = d;
2089                        SS[j] = di;
2090                        if ( ( j == N || i == M ) &&  c > SCORE )
2091                        { 
2092                                SCORE = c;
2093                                ENDI = i;
2094                                ENDJ = j;
2095                                STARI = ci;
2096                        }
2097                }
2098        }
2099        if ( SCORE )
2100                if ( STARI < 0 )
2101                { 
2102                        STARJ = - STARI;
2103                        STARI = 0;
2104                }
2105                else
2106                        STARJ = 0;
2107}
2108
2109/* diff(A,B,M,N,tb,te) returns the score of an optimum conversion between
2110   A[1..M] and B[1..N] that begins(ends) with a delete if tb(te) is zero
2111   and appends such a conversion to the current script.                   */
2112
2113int  diff(A,B,M,N,tb,te) char *A, *B; 
2114int  M, N; 
2115int  tb, te;
2116
2117{ 
2118        int    midi, midj, type;        /* Midpoint, type, and cost */
2119        int  midc;
2120
2121        { 
2122                register int    i, j;
2123                register int  c, e, d, s;
2124                int  t, *va;
2125                char  *my_calloc();
2126
2127                /* Boundary cases: M <= 1 or N == 0 */
2128
2129                if (N <= 0)
2130                { 
2131                        if (M > 0) DEL(M)
2132                                return - gap(M);
2133                }
2134                if (M <= 1)
2135                { 
2136                        if (M <= 0)
2137                        { 
2138                                INS(N);
2139                                return - gap(N);
2140                        }
2141                        if (tb > te) tb = te;
2142                        midc = - (tb + r + gap(N) );
2143                        midj = 0;
2144                        va = v[A[1]];
2145                        for (j = 1; j <= N; j++)
2146                        { 
2147                                c = va[B[j]] - ( gap(j-1) + gap(N-j) );
2148                                if (c > midc)
2149                                { 
2150                                        midc = c;
2151                                        midj = j;
2152                                }
2153                        }
2154                        if (midj == 0)
2155                        { 
2156                                INS(N) DEL(1)                   }
2157                        else
2158                        { 
2159                                if (midj > 1) INS(midj-1)
2160                                        REP
2161                                            if ( (A[1]|32) == (B[midj]|32) )
2162                                                no_mat += 1;
2163                                        else
2164                                                no_mis += 1;
2165                                if (midj < N) INS(N-midj)
2166                        }
2167                        return midc;
2168                }
2169
2170                /* Divide: Find optimum midpoint (midi,midj) of cost midc */
2171
2172                midi = M/2;                     /* Forward phase:                          */
2173                CC[0] = 0;                      /*   Compute C(M/2,k) & D(M/2,k) for all k */
2174                t = -q;
2175                for (j = 1; j <= N; j++)
2176                { 
2177                        CC[j] = t = t-r;
2178                        DD[j] = t-q;
2179                }
2180                t = -tb;
2181                for (i = 1; i <= midi; i++)
2182                { 
2183                        s = CC[0];
2184                        CC[0] = c = t = t-r;
2185                        e = t-q;
2186                        va = v[A[i]];
2187                        for (j = 1; j <= N; j++)
2188                        { 
2189                                if ((c = c - qr) > (e = e - r)) e = c;
2190                                if ((c = CC[j] - qr) > (d = DD[j] - r)) d = c;
2191                                c = s+va[B[j]];
2192                                if (c < d) c = d;
2193                                if (c < e) c = e;
2194                                s = CC[j];
2195                                CC[j] = c;
2196                                DD[j] = d;
2197                        }
2198                }
2199                DD[0] = CC[0];
2200
2201                RR[N] = 0;                      /* Reverse phase:                          */
2202                t = -q;                 /*   Compute R(M/2,k) & S(M/2,k) for all k */
2203                for (j = N-1; j >= 0; j--)
2204                { 
2205                        RR[j] = t = t-r;
2206                        SS[j] = t-q;
2207                }
2208                t = -te;
2209                for (i = M-1; i >= midi; i--)
2210                { 
2211                        s = RR[N];
2212                        RR[N] = c = t = t-r;
2213                        e = t-q;
2214                        va = v[A[i+1]];
2215                        for (j = N-1; j >= 0; j--)
2216                        { 
2217                                if ((c = c - qr) > (e = e - r)) e = c;
2218                                if ((c = RR[j] - qr) > (d = SS[j] - r)) d = c;
2219                                c =  s+va[B[j+1]];
2220                                if (c < d) c = d;
2221                                if (c < e) c = e;
2222                                s = RR[j];
2223                                RR[j] = c;
2224                                SS[j] = d;
2225                        }
2226                }
2227                SS[N] = RR[N];
2228
2229                midc = CC[0]+RR[0];             /* Find optimal midpoint */
2230                midj = 0;
2231                type = 1;
2232                for (j = 0; j <= N; j++)
2233                        if ((c = CC[j] + RR[j]) >= midc)
2234                                if (c > midc || CC[j] != DD[j] && RR[j] == SS[j])
2235                                { 
2236                                        midc = c;
2237                                        midj = j;
2238                                }
2239                for (j = N; j >= 0; j--)
2240                        if ((c = DD[j] + SS[j] + q) > midc)
2241                        { 
2242                                midc = c;
2243                                midj = j;
2244                                type = 2;
2245                        }
2246        }
2247
2248        /* Conquer: recursively around midpoint */
2249
2250        if (type == 1)
2251        {
2252                (void) diff(A,B,midi,midj,tb,q);
2253                (void) diff(A+midi,B+midj,M-midi,N-midj,q,te);
2254        }
2255        else
2256        {
2257                (void) diff(A,B,midi-1,midj,tb,zero);
2258                DEL(2);
2259                (void) diff(A+midi+1,B+midj,M-midi-1,N-midj,zero,te);
2260        }
2261        return midc;
2262}
2263
2264/* lib.c - library of C procedures. */
2265
2266/* fatal - print message and die */
2267fatal(msg)
2268char *msg;
2269{
2270        (void) fprintf(stderr, "%s\n", msg);
2271        exit(1);
2272}
2273
2274/* fatalf - format message, print it, and die */
2275fatalf(msg, val)
2276char *msg, *val;
2277{
2278        (void) fprintf(stderr, msg, val);
2279        (void)  putc('\n', stderr);
2280        exit(1);
2281}
2282
2283/* ckopen - open file; check for success */
2284FILE *ckopen(name, mode)
2285char *name, *mode;
2286{
2287        FILE *fopen(), *fp;
2288
2289        if ((fp = fopen(name, mode)) == NULL)
2290                fatalf("Cannot open %s.", name);
2291        return(fp);
2292}
2293
2294/* my_calloc - allocate space; check for success */
2295char *my_calloc(amount)
2296int  amount;
2297{
2298        char *malloc(), *p;
2299
2300        if ((p = malloc( (unsigned) amount)) == NULL)
2301                fatal("Ran out of memory.");
2302        return(p);
2303}
2304
Note: See TracBrowser for help on using the repository browser.