| 1 | // ================================================================ // |
|---|
| 2 | // // |
|---|
| 3 | // File : AWTC_next_neighbours.cxx // |
|---|
| 4 | // Purpose : // |
|---|
| 5 | // // |
|---|
| 6 | // Institute of Microbiology (Technical University Munich) // |
|---|
| 7 | // http://www.arb-home.de/ // |
|---|
| 8 | // // |
|---|
| 9 | // ================================================================ // |
|---|
| 10 | |
|---|
| 11 | #include "awtc_next_neighbours.hxx" |
|---|
| 12 | |
|---|
| 13 | #include <servercntrl.h> |
|---|
| 14 | #include <PT_com.h> |
|---|
| 15 | #include <client.h> |
|---|
| 16 | #include <aw_window.hxx> |
|---|
| 17 | #include <aw_root.hxx> |
|---|
| 18 | #include <arbdbt.h> |
|---|
| 19 | #include <arb_strbuf.h> |
|---|
| 20 | |
|---|
| 21 | #include <climits> |
|---|
| 22 | |
|---|
| 23 | struct PT_FF_comImpl { |
|---|
| 24 | aisc_com *link; |
|---|
| 25 | T_PT_MAIN com; |
|---|
| 26 | T_PT_LOCS locs; |
|---|
| 27 | |
|---|
| 28 | PT_FF_comImpl() |
|---|
| 29 | : link(NULL) |
|---|
| 30 | { |
|---|
| 31 | ff_assert(!com.exists()); |
|---|
| 32 | ff_assert(!locs.exists()); |
|---|
| 33 | } |
|---|
| 34 | }; |
|---|
| 35 | |
|---|
| 36 | // ------------------- |
|---|
| 37 | // FamilyList |
|---|
| 38 | |
|---|
| 39 | FamilyList::FamilyList() |
|---|
| 40 | : next(NULL), |
|---|
| 41 | name(NULL), |
|---|
| 42 | matches(0), |
|---|
| 43 | rel_matches(0.0) |
|---|
| 44 | {} |
|---|
| 45 | |
|---|
| 46 | FamilyList::~FamilyList() { |
|---|
| 47 | free(name); |
|---|
| 48 | delete next; |
|---|
| 49 | } |
|---|
| 50 | |
|---|
| 51 | FamilyList *FamilyList::insertSortedBy_matches(FamilyList *other) { |
|---|
| 52 | ff_assert(next == NULL); // only insert unlinked instace! |
|---|
| 53 | |
|---|
| 54 | if (!other) { |
|---|
| 55 | return this; |
|---|
| 56 | } |
|---|
| 57 | |
|---|
| 58 | if (matches >= other->matches) { |
|---|
| 59 | next = other; |
|---|
| 60 | return this; |
|---|
| 61 | } |
|---|
| 62 | |
|---|
| 63 | // insert into other |
|---|
| 64 | FamilyList *rest = other->next; |
|---|
| 65 | other->next = rest ? insertSortedBy_matches(rest) : this; |
|---|
| 66 | |
|---|
| 67 | return other; |
|---|
| 68 | } |
|---|
| 69 | |
|---|
| 70 | FamilyList *FamilyList::insertSortedBy_rel_matches(FamilyList *other) { |
|---|
| 71 | ff_assert(next == NULL); // only insert unlinked instace! |
|---|
| 72 | |
|---|
| 73 | if (rel_matches >= other->rel_matches) { |
|---|
| 74 | next = other; |
|---|
| 75 | return this; |
|---|
| 76 | } |
|---|
| 77 | |
|---|
| 78 | // insert into other |
|---|
| 79 | FamilyList *rest = other->next; |
|---|
| 80 | other->next = rest ? insertSortedBy_rel_matches(rest) : this; |
|---|
| 81 | |
|---|
| 82 | return other; |
|---|
| 83 | |
|---|
| 84 | } |
|---|
| 85 | |
|---|
| 86 | // --------------------- |
|---|
| 87 | // FamilyFinder |
|---|
| 88 | |
|---|
| 89 | FamilyFinder::FamilyFinder(bool rel_matches_, RelativeScoreScaling scaling_) |
|---|
| 90 | : rel_matches(rel_matches_), |
|---|
| 91 | scaling(scaling_), |
|---|
| 92 | family_list(NULL), |
|---|
| 93 | hits_truncated(false), |
|---|
| 94 | real_hits(-1), |
|---|
| 95 | range(-1, -1) |
|---|
| 96 | { |
|---|
| 97 | } |
|---|
| 98 | |
|---|
| 99 | FamilyFinder::~FamilyFinder() { |
|---|
| 100 | delete_family_list(); |
|---|
| 101 | } |
|---|
| 102 | |
|---|
| 103 | void FamilyFinder::delete_family_list() { |
|---|
| 104 | delete family_list; |
|---|
| 105 | family_list = NULL; |
|---|
| 106 | } |
|---|
| 107 | |
|---|
| 108 | // ------------------------ |
|---|
| 109 | // PT_FamilyFinder |
|---|
| 110 | |
|---|
| 111 | PT_FamilyFinder::PT_FamilyFinder(GBDATA *gb_main_, int server_id_, int oligo_len_, int mismatches_, bool fast_flag_, bool rel_matches_, RelativeScoreScaling scaling_) |
|---|
| 112 | : FamilyFinder(rel_matches_, scaling_), |
|---|
| 113 | gb_main(gb_main_), |
|---|
| 114 | server_id(server_id_), |
|---|
| 115 | oligo_len(oligo_len_), |
|---|
| 116 | mismatches(mismatches_), |
|---|
| 117 | fast_flag(fast_flag_) |
|---|
| 118 | { |
|---|
| 119 | // 'mismatches' = the number of allowed mismatches |
|---|
| 120 | // 'fast_flag' = 0 -> do complete search, 1 -> search only oligos starting with 'A' |
|---|
| 121 | // 'rel_matches' = 0 -> score is number of oligo-hits, 1 -> score is relative to longer sequence (target or source) * 10 |
|---|
| 122 | |
|---|
| 123 | ci = new PT_FF_comImpl; |
|---|
| 124 | } |
|---|
| 125 | |
|---|
| 126 | PT_FamilyFinder::~PT_FamilyFinder() { |
|---|
| 127 | delete_family_list(); |
|---|
| 128 | close(); |
|---|
| 129 | delete ci; |
|---|
| 130 | } |
|---|
| 131 | |
|---|
| 132 | GB_ERROR PT_FamilyFinder::init_communication() { |
|---|
| 133 | const char *user = "PT_FamilyFinder"; |
|---|
| 134 | |
|---|
| 135 | ff_assert(!ci->locs.exists()); |
|---|
| 136 | |
|---|
| 137 | // connect PT server |
|---|
| 138 | if (aisc_create(ci->link, PT_MAIN, ci->com, |
|---|
| 139 | MAIN_LOCS, PT_LOCS, ci->locs, |
|---|
| 140 | LOCS_USER, user, |
|---|
| 141 | NULL)) { |
|---|
| 142 | return GB_export_error("Cannot initialize communication"); |
|---|
| 143 | } |
|---|
| 144 | return 0; |
|---|
| 145 | } |
|---|
| 146 | |
|---|
| 147 | |
|---|
| 148 | GB_ERROR PT_FamilyFinder::open(const char *servername) { |
|---|
| 149 | GB_ERROR error = 0; |
|---|
| 150 | |
|---|
| 151 | ff_assert(!ci->com.exists() && !ci->link); |
|---|
| 152 | |
|---|
| 153 | if (arb_look_and_start_server(AISC_MAGIC_NUMBER, servername)) { |
|---|
| 154 | error = "Cannot contact PT server"; |
|---|
| 155 | } |
|---|
| 156 | else { |
|---|
| 157 | const char *socketid = GBS_read_arb_tcp(servername); |
|---|
| 158 | if (!socketid) error = GB_await_error(); |
|---|
| 159 | else { |
|---|
| 160 | ci->link = aisc_open(socketid, ci->com, AISC_MAGIC_NUMBER); |
|---|
| 161 | if (!ci->link) error = "Cannot contact PT server [1]"; |
|---|
| 162 | else if (init_communication()) error = "Cannot contact PT server [2]"; |
|---|
| 163 | } |
|---|
| 164 | } |
|---|
| 165 | |
|---|
| 166 | ff_assert(error || (ci->com.exists() && ci->link)); |
|---|
| 167 | |
|---|
| 168 | return error; |
|---|
| 169 | } |
|---|
| 170 | |
|---|
| 171 | void PT_FamilyFinder::close() { |
|---|
| 172 | if (ci->link) aisc_close(ci->link, ci->com); |
|---|
| 173 | ci->link = 0; |
|---|
| 174 | ff_assert(!ci->com.exists()); |
|---|
| 175 | ci->locs.clear(); |
|---|
| 176 | } |
|---|
| 177 | |
|---|
| 178 | GB_ERROR PT_FamilyFinder::retrieve_family(const char *sequence, FF_complement compl_mode, int max_results, double min_score) { |
|---|
| 179 | delete_family_list(); |
|---|
| 180 | |
|---|
| 181 | char *compressed_sequence = GB_command_interpreter(gb_main, sequence, "|keep(acgtunACGTUN)", 0, 0); |
|---|
| 182 | GB_ERROR error = NULL; |
|---|
| 183 | |
|---|
| 184 | if (!compressed_sequence) error = GB_await_error(); |
|---|
| 185 | else if (!compressed_sequence[0]) error = "No data in sequence(-region)"; |
|---|
| 186 | else { |
|---|
| 187 | bytestring bs; |
|---|
| 188 | bs.data = compressed_sequence; |
|---|
| 189 | bs.size = strlen(bs.data)+1; |
|---|
| 190 | |
|---|
| 191 | /* Start find_family() at the PT_SERVER |
|---|
| 192 | * |
|---|
| 193 | * Here we have to make a loop, until the match count of the |
|---|
| 194 | * first member is big enough |
|---|
| 195 | */ |
|---|
| 196 | |
|---|
| 197 | ff_assert(!range.is_empty()); |
|---|
| 198 | |
|---|
| 199 | // create and init family finder object |
|---|
| 200 | T_PT_FAMILYFINDER ffinder; |
|---|
| 201 | if (aisc_create(ci->link, PT_LOCS, ci->locs, |
|---|
| 202 | LOCS_FFINDER, PT_FAMILYFINDER, ffinder, |
|---|
| 203 | FAMILYFINDER_PROBE_LEN, long(oligo_len), // oligo length (12 hardcoded till July 2008) |
|---|
| 204 | FAMILYFINDER_MISMATCH_NUMBER, long(mismatches), // number of mismatches (0 hardcoded till July 2008) |
|---|
| 205 | FAMILYFINDER_FIND_TYPE, long(fast_flag), // 0: complete search, 1: quick search (only search oligos starting with 'A') |
|---|
| 206 | FAMILYFINDER_SORT_TYPE, long(uses_rel_matches()), // 0: matches, 1: relative matches (0 hardcoded till July 2008) |
|---|
| 207 | FAMILYFINDER_REL_SCORING, long(get_scaling()), // scaling of relative scores |
|---|
| 208 | FAMILYFINDER_SORT_MAX, long(max_results), // speed up family sorting (only sort retrieved results) |
|---|
| 209 | FAMILYFINDER_MIN_SCORE, min_score, // limit hits by score |
|---|
| 210 | FAMILYFINDER_COMPLEMENT, long(compl_mode), // any combination of: 1 = forward, 2 = reverse, 4 = reverse-complement, 8 = complement (1 hardcoded in PT-Server till July 2008) |
|---|
| 211 | FAMILYFINDER_RANGE_STARTPOS, long(range.start()), |
|---|
| 212 | FAMILYFINDER_RANGE_ENDPOS, long(range.is_limited() ? range.end() : -1), |
|---|
| 213 | FAMILYFINDER_FIND_FAMILY, &bs, // RPC (has to be last parameter!) |
|---|
| 214 | NULL)) |
|---|
| 215 | { |
|---|
| 216 | error = "Communication error with PT server ('retrieve_family')"; |
|---|
| 217 | } |
|---|
| 218 | else { |
|---|
| 219 | char *ff_error; |
|---|
| 220 | |
|---|
| 221 | // Read family list |
|---|
| 222 | T_PT_FAMILYLIST f_list; |
|---|
| 223 | aisc_get(ci->link, PT_FAMILYFINDER, ffinder, |
|---|
| 224 | FAMILYFINDER_FAMILY_LIST, f_list.as_result_param(), |
|---|
| 225 | FAMILYFINDER_FAMILY_LIST_SIZE, &real_hits, |
|---|
| 226 | FAMILYFINDER_ERROR, &ff_error, |
|---|
| 227 | NULL); |
|---|
| 228 | |
|---|
| 229 | if (ff_error[0]) { |
|---|
| 230 | error = GBS_global_string("PTSERVER: %s", ff_error); |
|---|
| 231 | } |
|---|
| 232 | else { |
|---|
| 233 | hits_truncated = false; |
|---|
| 234 | if (max_results<1) max_results = INT_MAX; |
|---|
| 235 | |
|---|
| 236 | FamilyList *tail = NULL; |
|---|
| 237 | while (f_list.exists()) { |
|---|
| 238 | if (max_results == 0) { |
|---|
| 239 | hits_truncated = true; |
|---|
| 240 | break; |
|---|
| 241 | } |
|---|
| 242 | max_results--; |
|---|
| 243 | |
|---|
| 244 | FamilyList *fl = new FamilyList(); |
|---|
| 245 | |
|---|
| 246 | (tail ? tail->next : family_list) = fl; |
|---|
| 247 | tail = fl; |
|---|
| 248 | fl->next = NULL; |
|---|
| 249 | |
|---|
| 250 | aisc_get(ci->link, PT_FAMILYLIST, f_list, |
|---|
| 251 | FAMILYLIST_NAME, &fl->name, |
|---|
| 252 | FAMILYLIST_MATCHES, &fl->matches, |
|---|
| 253 | FAMILYLIST_REL_MATCHES, &fl->rel_matches, |
|---|
| 254 | FAMILYLIST_NEXT, f_list.as_result_param(), |
|---|
| 255 | NULL); |
|---|
| 256 | } |
|---|
| 257 | } |
|---|
| 258 | free(ff_error); |
|---|
| 259 | } |
|---|
| 260 | |
|---|
| 261 | free(compressed_sequence); |
|---|
| 262 | } |
|---|
| 263 | return error; |
|---|
| 264 | } |
|---|
| 265 | |
|---|
| 266 | GB_ERROR PT_FamilyFinder::searchFamily(const char *sequence, FF_complement compl_mode, int max_results, double min_score) { |
|---|
| 267 | // searches the PT-server for species related to 'sequence'. |
|---|
| 268 | // |
|---|
| 269 | // relation-score is calculated by fragmenting the sequence into oligos of length 'oligo_len' and |
|---|
| 270 | // then summarizing the number of hits. |
|---|
| 271 | // |
|---|
| 272 | // 'max_results' limits the length of the generated result list (low scores deleted first) |
|---|
| 273 | // if < 1 -> don't limit |
|---|
| 274 | // |
|---|
| 275 | // 'min_score' limits the results by score (use 0 for unlimited results) |
|---|
| 276 | // |
|---|
| 277 | // When using restrict_2_region(), only pass the corresponding part via 'sequence' (not the full alignment) |
|---|
| 278 | |
|---|
| 279 | GB_ERROR error = range.is_empty() ? "Specified range is empty" : NULL; |
|---|
| 280 | if (!error) { |
|---|
| 281 | error = open(GBS_ptserver_tag(server_id)); |
|---|
| 282 | if (!error) error = retrieve_family(sequence, compl_mode, max_results, min_score); |
|---|
| 283 | close(); |
|---|
| 284 | } |
|---|
| 285 | return error; |
|---|
| 286 | } |
|---|
| 287 | |
|---|
| 288 | const char *PT_FamilyFinder::results2string() { |
|---|
| 289 | GBS_strstruct *out = GBS_stropen(1000); |
|---|
| 290 | for (FamilyList *fl = family_list; fl; fl = fl->next) { |
|---|
| 291 | GBS_strnprintf(out, 100, "%s/%li/%3.5f,", fl->name, fl->matches, fl->rel_matches*100); |
|---|
| 292 | } |
|---|
| 293 | GBS_str_cut_tail(out, 1); |
|---|
| 294 | RETURN_LOCAL_ALLOC(GBS_strclose(out)); |
|---|
| 295 | } |
|---|
| 296 | |
|---|
| 297 | void AWTC_create_common_next_neighbour_vars(AW_root *aw_root) { |
|---|
| 298 | static bool created = false; |
|---|
| 299 | if (!created) { |
|---|
| 300 | aw_root->awar_int(AWAR_NN_OLIGO_LEN, 12); |
|---|
| 301 | aw_root->awar_int(AWAR_NN_MISMATCHES, 0); |
|---|
| 302 | aw_root->awar_int(AWAR_NN_FAST_MODE, 0); |
|---|
| 303 | aw_root->awar_int(AWAR_NN_REL_MATCHES, 1); |
|---|
| 304 | aw_root->awar_int(AWAR_NN_REL_SCALING, RSS_BOTH_MIN); |
|---|
| 305 | |
|---|
| 306 | created = true; |
|---|
| 307 | } |
|---|
| 308 | } |
|---|
| 309 | |
|---|
| 310 | void AWTC_create_common_next_neighbour_fields(AW_window *aws) { |
|---|
| 311 | // used in several figs: |
|---|
| 312 | // - ad_spec_nn.fig |
|---|
| 313 | // - ad_spec_nnm.fig |
|---|
| 314 | // - faligner/family_settings.fig |
|---|
| 315 | |
|---|
| 316 | aws->at("oligo_len"); |
|---|
| 317 | aws->create_input_field(AWAR_NN_OLIGO_LEN, 3); |
|---|
| 318 | |
|---|
| 319 | aws->at("mismatches"); |
|---|
| 320 | aws->create_input_field(AWAR_NN_MISMATCHES, 3); |
|---|
| 321 | |
|---|
| 322 | aws->at("mode"); |
|---|
| 323 | aws->create_option_menu(AWAR_NN_FAST_MODE, 0, 0); |
|---|
| 324 | aws->insert_default_option("Complete", "", 0); |
|---|
| 325 | aws->insert_option("Quick", "", 1); |
|---|
| 326 | aws->update_option_menu(); |
|---|
| 327 | |
|---|
| 328 | aws->at("score"); |
|---|
| 329 | aws->create_option_menu(AWAR_NN_REL_MATCHES, 0, 0); |
|---|
| 330 | aws->insert_option("absolute", "", 0); |
|---|
| 331 | aws->insert_default_option("relative", "", 1); |
|---|
| 332 | aws->update_option_menu(); |
|---|
| 333 | |
|---|
| 334 | aws->at("scaling"); |
|---|
| 335 | aws->create_option_menu(AWAR_NN_REL_SCALING, 0, 0); |
|---|
| 336 | aws->insert_option ("to source POC", "", RSS_SOURCE); |
|---|
| 337 | aws->insert_option ("to target POC", "", RSS_TARGET); |
|---|
| 338 | aws->insert_default_option("to maximum POC", "", RSS_BOTH_MAX); |
|---|
| 339 | aws->insert_option ("to minimum POC", "", RSS_BOTH_MIN); |
|---|
| 340 | aws->update_option_menu(); |
|---|
| 341 | } |
|---|
| 342 | |
|---|
| 343 | // -------------------------------------------------------------------------------- |
|---|
| 344 | |
|---|
| 345 | #ifdef UNIT_TESTS |
|---|
| 346 | |
|---|
| 347 | #include <test_unit.h> |
|---|
| 348 | |
|---|
| 349 | class ff_tester { |
|---|
| 350 | GBDATA *gb_main; |
|---|
| 351 | public: |
|---|
| 352 | bool relativeMatches; |
|---|
| 353 | bool fastMode; |
|---|
| 354 | bool partial; |
|---|
| 355 | bool shortOligo; |
|---|
| 356 | double min_score; |
|---|
| 357 | |
|---|
| 358 | RelativeScoreScaling scaling; |
|---|
| 359 | |
|---|
| 360 | ff_tester(GBDATA *gb_main_) |
|---|
| 361 | : gb_main(gb_main_), |
|---|
| 362 | relativeMatches(false), |
|---|
| 363 | fastMode(false), |
|---|
| 364 | partial(false), |
|---|
| 365 | shortOligo(false), |
|---|
| 366 | min_score(0.0), |
|---|
| 367 | scaling(RSS_BOTH_MAX) |
|---|
| 368 | {} |
|---|
| 369 | |
|---|
| 370 | const char *get_result(GB_ERROR& error) { |
|---|
| 371 | int oligoLen = shortOligo ? (partial ? 3 : 6) : (partial ? 10 : 18); |
|---|
| 372 | PT_FamilyFinder ff(gb_main, TEST_SERVER_ID, oligoLen, 1, fastMode, relativeMatches, scaling); |
|---|
| 373 | |
|---|
| 374 | const char *sequence; |
|---|
| 375 | if (partial) { |
|---|
| 376 | ff.restrict_2_region(PosRange(39, 91)); // alignment range of bases 30-69 of sequence of 'LgtLytic' |
|---|
| 377 | sequence = "UCUAGCUUGCUAGACGGGUGGCGAG" "GGUAACCGUAGGGGA"; // bases 30-54 of sequence of 'LgtLytic' + 15 bases from 'DcdNodos' (outside region) |
|---|
| 378 | } |
|---|
| 379 | else { |
|---|
| 380 | // sequence of 'LgtLytic' in TEST_pt.arb: |
|---|
| 381 | sequence = "AGAGUUUGAUCAAGUCGAACGGCAGCACAGUCUAGCUUGCUAGACGGGUGGCGAGUGGCGAACGGACUUGGGGAAACUCAAGCUAAUACCGCAUAAUCAUGACUGGGGUGAAGUCGUAACAAGGUAGCCGUAGGGGAACCUGCGGCUGGAUCACCUCCUN"; |
|---|
| 382 | } |
|---|
| 383 | |
|---|
| 384 | error = ff.searchFamily(sequence, FF_FORWARD, 4, min_score); |
|---|
| 385 | return ff.results2string(); |
|---|
| 386 | } |
|---|
| 387 | }; |
|---|
| 388 | |
|---|
| 389 | |
|---|
| 390 | #define TEST_RELATIVES_COMMON(tester,expctd) \ |
|---|
| 391 | GB_ERROR error; \ |
|---|
| 392 | const char *result = tester.get_result(error); \ |
|---|
| 393 | const char *expected = expctd; \ |
|---|
| 394 | TEST_ASSERT_NO_ERROR(error); \ |
|---|
| 395 | |
|---|
| 396 | #define TEST_ASSERT_RELATIVES(tester,expctd) do { \ |
|---|
| 397 | TEST_RELATIVES_COMMON(tester,expctd); \ |
|---|
| 398 | TEST_ASSERT_EQUAL(result, expected); \ |
|---|
| 399 | } while(0) |
|---|
| 400 | |
|---|
| 401 | #define TEST_ASSERT_REL__BROK(tester,expctd) do { \ |
|---|
| 402 | TEST_RELATIVES_COMMON(tester,expctd); \ |
|---|
| 403 | TEST_ASSERT_EQUAL__BROKEN(result, expected); \ |
|---|
| 404 | } while(0) |
|---|
| 405 | |
|---|
| 406 | void TEST_SLOW_PT_FamilyFinder() { |
|---|
| 407 | GB_shell shell; |
|---|
| 408 | TEST_SETUP_GLOBAL_ENVIRONMENT("ptserver"); |
|---|
| 409 | |
|---|
| 410 | GBDATA *gb_main = GB_open("no.arb", "c"); |
|---|
| 411 | |
|---|
| 412 | // check some error cases |
|---|
| 413 | { |
|---|
| 414 | PT_FamilyFinder ffe(gb_main, TEST_SERVER_ID, 0, 1, 0, 0, RSS_BOTH_MAX); |
|---|
| 415 | TEST_ASSERT_CONTAINS(ffe.searchFamily("whatever", FF_FORWARD, 4, 0.0), "minimum oligo length is 1"); |
|---|
| 416 | } |
|---|
| 417 | |
|---|
| 418 | ff_tester test(gb_main); |
|---|
| 419 | |
|---|
| 420 | ff_tester ______RESET = test; TEST_ASSERT_RELATIVES(test, "LgtLytic/142/97.93103,HllHalod/62/43.05556,AclPleur/59/38.06452,PtVVVulg/52/34.21053"); |
|---|
| 421 | test.partial = true; TEST_ASSERT_RELATIVES(test, "LgtLytic/18/11.76471,VblVulni/5/3.24675,VbhChole/4/2.59740,DcdNodos/4/2.59740"); |
|---|
| 422 | test.shortOligo = true; TEST_ASSERT_RELATIVES(test, "PtVVVulg/38/22.75449,AclPleur/38/22.35294,VbhChole/38/23.60248,VblVulni/38/23.60248"); |
|---|
| 423 | test.relativeMatches = true; TEST_ASSERT_RELATIVES(test, "DsssDesu/38/38.77551,CltBotul/38/34.23423,PsAAAA00/38/32.75862,Bl0LLL00/38/25.67568"); |
|---|
| 424 | test.min_score = 32.6; TEST_ASSERT_RELATIVES(test, "DsssDesu/38/38.77551,CltBotul/38/34.23423,PsAAAA00/38/32.75862"); |
|---|
| 425 | test = ______RESET; |
|---|
| 426 | test.shortOligo = true; TEST_ASSERT_RELATIVES(test, "LgtLytic/153/97.45223,AclPleur/138/82.63473,VbhChole/133/84.17722,VblVulni/133/84.17722"); |
|---|
| 427 | test.relativeMatches = true; TEST_ASSERT_RELATIVES(test, "LgtLytic/153/97.45223,HllHalod/133/85.25641,VbhChole/133/84.17722,VblVulni/133/84.17722"); |
|---|
| 428 | test.fastMode = true; TEST_ASSERT_RELATIVES(test, "LgtLytic/42/26.75159,VblVulni/37/23.41772,HllHalod/36/23.07692,Stsssola/36/23.07692"); |
|---|
| 429 | test.min_score = 26.7; TEST_ASSERT_RELATIVES(test, "LgtLytic/42/26.75159"); |
|---|
| 430 | test.min_score = 26.8; TEST_ASSERT_RELATIVES(test, ""); |
|---|
| 431 | test = ______RESET; |
|---|
| 432 | test.fastMode = true; TEST_ASSERT_RELATIVES(test, "LgtLytic/40/27.58621,HllHalod/18/12.50000,AclPleur/17/10.96774,PtVVVulg/15/9.86842"); |
|---|
| 433 | test.min_score = 17.0; TEST_ASSERT_RELATIVES(test, "LgtLytic/40/27.58621,HllHalod/18/12.50000,AclPleur/17/10.96774"); |
|---|
| 434 | test.min_score = 17.5; TEST_ASSERT_RELATIVES(test, "LgtLytic/40/27.58621,HllHalod/18/12.50000"); |
|---|
| 435 | test = ______RESET; |
|---|
| 436 | |
|---|
| 437 | test.shortOligo = true; |
|---|
| 438 | test.relativeMatches = true; |
|---|
| 439 | test.scaling = RSS_BOTH_MAX; TEST_ASSERT_RELATIVES(test, "LgtLytic/153/97.45223,HllHalod/133/85.25641,VbhChole/133/84.17722,VblVulni/133/84.17722"); |
|---|
| 440 | test.scaling = RSS_BOTH_MIN; TEST_ASSERT_RELATIVES(test, "LgtLytic/153/98.07692,AclPleur/138/88.46154,DsssDesu/84/88.42105,CltBotul/95/87.96296"); |
|---|
| 441 | test.scaling = RSS_TARGET; TEST_ASSERT_RELATIVES(test, "LgtLytic/153/97.45223,DsssDesu/84/88.42105,CltBotul/95/87.96296,PsAAAA00/97/85.84071"); |
|---|
| 442 | test.scaling = RSS_SOURCE; TEST_ASSERT_RELATIVES(test, "LgtLytic/153/98.07692,AclPleur/138/88.46154,VbhChole/133/85.25641,VblVulni/133/85.25641"); |
|---|
| 443 | test.partial = true; |
|---|
| 444 | test.shortOligo = false; |
|---|
| 445 | test.scaling = RSS_BOTH_MAX; TEST_ASSERT_RELATIVES(test, "LgtLytic/18/11.76471,VblVulni/5/3.24675,VbhChole/4/2.59740,DcdNodos/4/2.59740"); |
|---|
| 446 | test.scaling = RSS_BOTH_MIN; TEST_ASSERT_RELATIVES(test, "LgtLytic/18/56.25000,VblVulni/5/15.62500,VbhChole/4/12.50000,DcdNodos/4/12.50000"); |
|---|
| 447 | test.scaling = RSS_TARGET; TEST_ASSERT_RELATIVES(test, "LgtLytic/18/11.76471,VblVulni/5/3.24675,VbhChole/4/2.59740,DcdNodos/4/2.59740"); |
|---|
| 448 | test.scaling = RSS_SOURCE; TEST_ASSERT_RELATIVES(test, "LgtLytic/18/56.25000,VblVulni/5/15.62500,VbhChole/4/12.50000,DcdNodos/4/12.50000"); |
|---|
| 449 | test = ______RESET; |
|---|
| 450 | |
|---|
| 451 | GB_close(gb_main); |
|---|
| 452 | } |
|---|
| 453 | |
|---|
| 454 | #endif |
|---|