| 1 | #- |
|---|
| 2 | #- |
|---|
| 3 | #- editor |
|---|
| 4 | #- Mon Oct 25 12:13:24 2010 |
|---|
| 5 | #- |
|---|
| 6 | #- |
|---|
| 7 | #- Reference sequence: AF375552; |
|---|
| 8 | #- Attributes: |
|---|
| 9 | #= AF375552; in out vis prt ord dna lin 5>3 func ref |
|---|
| 10 | #= HSFAU in out vis prt ord dna lin 5>3 func |
|---|
| 11 | #= HSFAU1 in out vis prt ord dna lin 5>3 func |
|---|
| 12 | #- |
|---|
| 13 | #:AF375552;:name:Lactococcus lactis subsp. lactis. |
|---|
| 14 | #:AF375552;:strain:NCDO2118 tmRNA gene, partial sequence |
|---|
| 15 | #:AF375552;:subsp:lactis |
|---|
| 16 | #:AF375552;:atcc:NCDO 2118 tmRNA gene |
|---|
| 17 | #:AF375552;:date:31-MAY-2001 |
|---|
| 18 | #:AF375552;:acs:AF375552; |
|---|
| 19 | #:AF375552;:auth:Schoenhuber,W., Le Bourhis,G., Tremblay,J., Amann,R. and |
|---|
| 20 | #:AF375552;:auth:Kulakauskas,S. |
|---|
| 21 | #:AF375552;:jour:BMC Microbiol. 1(1), 20-20 (2001) |
|---|
| 22 | #:AF375552;:title:Utilization of tmRNA sequences for bacterial identification |
|---|
| 23 | #:AF375552;:rem:ref:1 (bases 1 to 310) |
|---|
| 24 | #:AF375552;:rem:ref:2 (bases 1 to 310) |
|---|
| 25 | #:AF375552;:rem:auth:Schoenhuber,W., Le Bourhis,G., Tremblay,J., Amann,R.I. |
|---|
| 26 | #:AF375552;:rem:: and Kulakauskas,S. |
|---|
| 27 | #:AF375552;:rem:jour:Submitted (02-MAY-2001) to the EMBL/GenBank/DDBJ |
|---|
| 28 | #:AF375552;:rem:: databases. Microbiology, Institut National de la Recherche |
|---|
| 29 | #:AF375552;:rem:: Agronomique, Domaine de Vilvert, Jouy-en-Josas 78352, |
|---|
| 30 | #:AF375552;:rem:: France |
|---|
| 31 | #:AF375552;:rem:standard:No information |
|---|
| 32 | #:AF375552;:rem:KEYWORDS:No information. |
|---|
| 33 | #:AF375552;:rem:GenBank ACCESSION:AF375552 |
|---|
| 34 | #:AF375552;:rem:Please note: all these entries have been modified for test |
|---|
| 35 | #:AF375552;:rem:purposes. |
|---|
| 36 | #:AF375552;:rem:*source: strain=NCDO2118 tmRNA gene, partial sequence; |
|---|
| 37 | #:AF375552;:rem:*source: subspecies=lactis; |
|---|
| 38 | #:HSFAU:name:H.sapiens fau |
|---|
| 39 | #:HSFAU:date:25-OCT-2010 |
|---|
| 40 | #:HSFAU:acs:X65923 |
|---|
| 41 | #:HSFAU:rem:GenBank ACCESSION:X65923 |
|---|
| 42 | #:HSFAU1:name:H.sapiens fau |
|---|
| 43 | #:HSFAU1:rna:This is the content of the special entry 'Sequencing methods' |
|---|
| 44 | #:HSFAU1:date:25-OCT-2010 |
|---|
| 45 | #:HSFAU1:acs:X65921; |
|---|
| 46 | #:HSFAU1:rem:GenBank ACCESSION:X65921 |
|---|
| 47 | #:HSFAU1:rem:Source of strain:This is the content of the special entry 'Source |
|---|
| 48 | #:HSFAU1:rem:: of strain' |
|---|
| 49 | #:HSFAU1:rem:Former name:This is the content of the special entry 'Former |
|---|
| 50 | #:HSFAU1:rem:: name' |
|---|
| 51 | #:HSFAU1:rem:Alternate name:This is the content of the special entry |
|---|
| 52 | #:HSFAU1:rem:: 'Alternate name'. It is quite long, since i need to test some |
|---|
| 53 | #:HSFAU1:rem:: special entry which occupies many lines and when i say many |
|---|
| 54 | #:HSFAU1:rem:: lines, i really mean at least five lines, so i could not stop |
|---|
| 55 | #:HSFAU1:rem:: writing before i came here. |
|---|
| 56 | #:HSFAU1:rem:Common name:This is the content of the special entry 'Common |
|---|
| 57 | #:HSFAU1:rem:: name' |
|---|
| 58 | #:HSFAU1:rem:Host organism:This is the content of the special entry 'Host |
|---|
| 59 | #:HSFAU1:rem:: organism' |
|---|
| 60 | #:HSFAU1:rem:RDP ID:This is the content of the special entry 'RDP ID' |
|---|
| 61 | #:HSFAU1:rem:Sequencing methods:This is the content of the special entry |
|---|
| 62 | #:HSFAU1:rem:: 'Sequencing methods' |
|---|
| 63 | #:HSFAU1:rem:3' end complete: No |
|---|
| 64 | #:HSFAU1:rem:5' end complete: Yes |
|---|
| 65 | #:HSFAU1:rem:Organism and Sequence information have only been added for |
|---|
| 66 | #:HSFAU1:rem:test purposes. They are complete nonsense! |
|---|
| 67 | AF375552; 0 cattgtcgcgcatgaactgcaactgctgagggatcaggataatcatccgc |
|---|
| 68 | AF375552; 50 agataaatataactgctaaaaataatacacaaacttacgcaatggcagcc |
|---|
| 69 | AF375552; 100 taaacagcaccatgcgtgcctgatttttgctcactgatggcaatttgacg |
|---|
| 70 | AF375552; 150 gcctaaacttttagtcagatacgttgttgtggaggcttgacgcagcaaaa |
|---|
| 71 | AF375552; 200 gagatttaaagccccgcaaaatgtcgctgtttgagactggctttggcatt |
|---|
| 72 | AF375552; 250 ttgttaaatttgagaaagtcctatggttgtagacgttgatgtagcaaggt |
|---|
| 73 | AF375552; 300 gtttggacag |
|---|
| 74 | HSFAU 0 ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtc |
|---|
| 75 | HSFAU 50 gccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggt |
|---|
| 76 | HSFAU 100 gaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactgg |
|---|
| 77 | HSFAU 150 agggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctg |
|---|
| 78 | HSFAU 200 gaggatgaggccactctgggccagtgcggggtggaggccctgactaccct |
|---|
| 79 | HSFAU 250 ggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc |
|---|
| 80 | HSFAU 300 gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaag |
|---|
| 81 | HSFAU 350 aagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcg |
|---|
| 82 | HSFAU 400 ctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgcca |
|---|
| 83 | HSFAU 450 actcttaagtcttttgtaattctggctttctctaataaaaaagccactta |
|---|
| 84 | HSFAU 500 gttcagtcaaaaaaaaaa |
|---|
| 85 | HSFAU1 0 ctaccattttccctctcgattctatatgtacactcgggacaagttctcct |
|---|
| 86 | HSFAU1 50 gatcgaaaacggcaaaactaaggccccaagtaggaatgccttagttttcg |
|---|
| 87 | HSFAU1 100 gggttaacaatgattaacactgagcctcacacccacgcgatgccctcagc |
|---|
| 88 | HSFAU1 150 tcctcgctcagcgctctcaccaacagccgtagcccgcagccccgctggac |
|---|
| 89 | HSFAU1 200 accggttctccatccccgcagcgtagcccggaacatggtagctgccatct |
|---|
| 90 | HSFAU1 250 ttacctgctacgccagccttctgtgcgcgcaactgtctggtcccgccccg |
|---|
| 91 | HSFAU1 300 tcctgcgcgagctgctgcccaggcaggttcgccggtgcgagcgtaaaggg |
|---|
| 92 | HSFAU1 350 gcggagctaggactgccttgggcggtacaaatagcagggaaccgcgcggt |
|---|
| 93 | HSFAU1 400 cgctcagcagtgacgtgacacgcagcccacggtctgtactgacgcgccct |
|---|
| 94 | HSFAU1 450 cgcttcttcctctttctcgactccatcttcgcggtagctgggaccgccgt |
|---|
| 95 | HSFAU1 500 tcaggtaagaatggggccttggctggatccgaagggcttgtagcaggttg |
|---|
| 96 | HSFAU1 550 gctgcggggtcagaaggcgcggggggaaccgaagaacggggcctgctccg |
|---|
| 97 | HSFAU1 600 tggccctgctccagtccctatccgaactccttgggaggcactggccttcc |
|---|
| 98 | HSFAU1 650 gcacgtgagccgccgcgaccaccatcccgtcgcgatcgtttctggaccgc |
|---|
| 99 | HSFAU1 700 tttccactcccaaatctcctttatcccagagcatttcttggcttctctta |
|---|
| 100 | HSFAU1 750 caagccgtcttttctttactcagtcgccaatatgcagctctttgtccgcg |
|---|
| 101 | HSFAU1 800 cccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag |
|---|
| 102 | HSFAU1 850 atcaaggtaaggctgcttggtgcgccctgggttccattttcttgtgctct |
|---|
| 103 | HSFAU1 900 tcactctcgcggcccgagggaacgcttacgagccttatctttccctgtag |
|---|
| 104 | HSFAU1 950 gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgct |
|---|
| 105 | HSFAU1 1000 cctggcaggcgcgcccctggaggatgaggccactctgggccagtgcgggg |
|---|
| 106 | HSFAU1 1050 tggaggccctgactaccctggaagtagcaggccgcatgcttggaggtgag |
|---|
| 107 | HSFAU1 1100 tgagagaggaatgttctttgaagtaccggtaagcgtctagtgagtgtggg |
|---|
| 108 | HSFAU1 1150 gtgcatagtcctgacagctgagtgtcacacctatggtaatagagtacttc |
|---|
| 109 | HSFAU1 1200 tcactgtcttcagttcagagtgattcttcctgtttacatccctcatgttg |
|---|
| 110 | HSFAU1 1250 aacacagacgtccatgggagactgagccagagtgtagttgtatttcagtc |
|---|
| 111 | HSFAU1 1300 acatcacgagatcctagtctggttatcagcttccacactaaaaattaggt |
|---|
| 112 | HSFAU1 1350 cagaccaggccccaaagtgctctataaattagaagctggaagatcctgaa |
|---|
| 113 | HSFAU1 1400 atgaaacttaagatttcaaggtcaaatatctgcaactttgttctcattac |
|---|
| 114 | HSFAU1 1450 ctattgggcgcagcttctctttaaaggcttgaattgagaaaagaggggtt |
|---|
| 115 | HSFAU1 1500 ctgctgggtggcaccttcttgctcttacctgctggtgccttcctttccca |
|---|
| 116 | HSFAU1 1550 ctacaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggt |
|---|
| 117 | HSFAU1 1600 cagactcctaaggtgagtgagagtattagtggtcatggtgttaggacttt |
|---|
| 118 | HSFAU1 1650 ttttcctttcacagctaaaccaagtccctgggctcttactcggtttgcct |
|---|
| 119 | HSFAU1 1700 tctccctccctggagatgagcctgagggaagggatgctaggtgtggaaga |
|---|
| 120 | HSFAU1 1750 caggaaccagggcctgattaaccttcccttctccaggtggccaaacagga |
|---|
| 121 | HSFAU1 1800 gaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaacc |
|---|
| 122 | HSFAU1 1850 ggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaat |
|---|
| 123 | HSFAU1 1900 gccaactcttaagtcttttgtaattctggctttctctaataaaaaagcca |
|---|
| 124 | HSFAU1 1950 cttagttcagtcatcgcattgtttcatctttacttgcaaggcctcaggga |
|---|
| 125 | HSFAU1 2000 gaggtgtgcttctcgg |
|---|