| 1 | // =============================================================== // |
|---|
| 2 | // // |
|---|
| 3 | // File : adGene.cxx // |
|---|
| 4 | // Purpose : Basic gene access functions // |
|---|
| 5 | // // |
|---|
| 6 | // Coded by Ralf Westram (coder@reallysoft.de) in July 2002 // |
|---|
| 7 | // Institute of Microbiology (Technical University Munich) // |
|---|
| 8 | // http://www.arb-home.de/ // |
|---|
| 9 | // // |
|---|
| 10 | // =============================================================== // |
|---|
| 11 | |
|---|
| 12 | #include "gb_local.h" |
|---|
| 13 | |
|---|
| 14 | #include <adGene.h> |
|---|
| 15 | #include <arbdbt.h> |
|---|
| 16 | #include <arb_strbuf.h> |
|---|
| 17 | #include <arb_strarray.h> |
|---|
| 18 | |
|---|
| 19 | |
|---|
| 20 | bool GEN_is_genome_db(GBDATA *gb_main, int default_value) { |
|---|
| 21 | // default_value == 0 -> default to normal database |
|---|
| 22 | // == 1 -> default to GENOM database |
|---|
| 23 | // == -1 -> assume that type is already defined |
|---|
| 24 | GBDATA *gb_genom_db = GB_entry(gb_main, GENOM_DB_TYPE); |
|---|
| 25 | |
|---|
| 26 | if (!gb_genom_db) { // no DB-type entry -> create one with default |
|---|
| 27 | GB_ERROR error = NULL; |
|---|
| 28 | |
|---|
| 29 | assert_or_exit(default_value != -1); // first call to GEN_is_genome_db has to provide a 'default_value' |
|---|
| 30 | |
|---|
| 31 | gb_genom_db = GB_create(gb_main, GENOM_DB_TYPE, GB_INT); |
|---|
| 32 | if (!gb_genom_db) error = GB_await_error(); |
|---|
| 33 | else error = GB_write_int(gb_genom_db, default_value); |
|---|
| 34 | |
|---|
| 35 | if (error) GBK_terminatef("Fatal in GEN_is_genome_db: %s", error); |
|---|
| 36 | } |
|---|
| 37 | |
|---|
| 38 | return GB_read_int(gb_genom_db) != 0; |
|---|
| 39 | } |
|---|
| 40 | |
|---|
| 41 | // -------------- |
|---|
| 42 | // genes: |
|---|
| 43 | |
|---|
| 44 | GBDATA* GEN_findOrCreate_gene_data(GBDATA *gb_species) { |
|---|
| 45 | GBDATA *gb_gene_data = GB_search(gb_species, "gene_data", GB_CREATE_CONTAINER); |
|---|
| 46 | gb_assert(gb_gene_data); |
|---|
| 47 | return gb_gene_data; |
|---|
| 48 | } |
|---|
| 49 | |
|---|
| 50 | GBDATA* GEN_find_gene_data(GBDATA *gb_species) { |
|---|
| 51 | return GB_search(gb_species, "gene_data", GB_FIND); |
|---|
| 52 | } |
|---|
| 53 | |
|---|
| 54 | GBDATA* GEN_expect_gene_data(GBDATA *gb_species) { |
|---|
| 55 | GBDATA *gb_gene_data = GB_search(gb_species, "gene_data", GB_FIND); |
|---|
| 56 | gb_assert(gb_gene_data); |
|---|
| 57 | return gb_gene_data; |
|---|
| 58 | } |
|---|
| 59 | |
|---|
| 60 | GBDATA* GEN_find_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) { |
|---|
| 61 | GBDATA *gb_name = GB_find_string(gb_gene_data, "name", name, GB_IGNORE_CASE, SEARCH_GRANDCHILD); |
|---|
| 62 | |
|---|
| 63 | if (gb_name) return GB_get_father(gb_name); // found existing gene |
|---|
| 64 | return 0; |
|---|
| 65 | } |
|---|
| 66 | |
|---|
| 67 | GBDATA* GEN_find_gene(GBDATA *gb_species, const char *name) { |
|---|
| 68 | // find existing gene. returns 0 if it does not exist. |
|---|
| 69 | GBDATA *gb_gene_data = GEN_find_gene_data(gb_species); |
|---|
| 70 | return gb_gene_data ? GEN_find_gene_rel_gene_data(gb_gene_data, name) : 0; |
|---|
| 71 | } |
|---|
| 72 | |
|---|
| 73 | static GBDATA* GEN_create_nonexisting_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) { |
|---|
| 74 | GB_ERROR error = GB_push_transaction(gb_gene_data); |
|---|
| 75 | GBDATA *gb_gene = 0; |
|---|
| 76 | |
|---|
| 77 | gb_assert(!GEN_find_gene_rel_gene_data(gb_gene_data, name)); // don't call this function if you are not sure that the gene does not exists! |
|---|
| 78 | |
|---|
| 79 | if (!error) { |
|---|
| 80 | gb_gene = GB_create_container(gb_gene_data, "gene"); |
|---|
| 81 | error = gb_gene ? GBT_write_string(gb_gene, "name", name) : GB_await_error(); |
|---|
| 82 | } |
|---|
| 83 | |
|---|
| 84 | gb_assert(gb_gene || error); |
|---|
| 85 | error = GB_end_transaction(gb_gene_data, error); |
|---|
| 86 | if (error) GB_export_error(error); |
|---|
| 87 | |
|---|
| 88 | return gb_gene; |
|---|
| 89 | } |
|---|
| 90 | |
|---|
| 91 | GBDATA* GEN_create_nonexisting_gene(GBDATA *gb_species, const char *name) { // needed by ../PERL_SCRIPTS/GENOME/GI.pm@create_nonexisting_gene |
|---|
| 92 | return GEN_create_nonexisting_gene_rel_gene_data(GEN_findOrCreate_gene_data(gb_species), name); |
|---|
| 93 | } |
|---|
| 94 | |
|---|
| 95 | GBDATA* GEN_find_or_create_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) { |
|---|
| 96 | GBDATA *gb_gene = 0; |
|---|
| 97 | |
|---|
| 98 | // Search for a gene, when gene does not exist create it |
|---|
| 99 | if (!name || !name[0]) { |
|---|
| 100 | GB_export_error("Missing gene name"); |
|---|
| 101 | } |
|---|
| 102 | else { |
|---|
| 103 | GBDATA *gb_name = GB_find_string(gb_gene_data, "name", name, GB_IGNORE_CASE, SEARCH_GRANDCHILD); |
|---|
| 104 | |
|---|
| 105 | if (gb_name) { |
|---|
| 106 | gb_gene = GB_get_father(gb_name); // found existing gene |
|---|
| 107 | } |
|---|
| 108 | else { |
|---|
| 109 | GB_ERROR error = GB_push_transaction(gb_gene_data); |
|---|
| 110 | |
|---|
| 111 | if (!error) { |
|---|
| 112 | gb_gene = GB_create_container(gb_gene_data, "gene"); |
|---|
| 113 | error = GBT_write_string(gb_gene, "name", name); |
|---|
| 114 | } |
|---|
| 115 | error = GB_end_transaction(gb_gene_data, error); |
|---|
| 116 | if (error) { |
|---|
| 117 | gb_gene = NULL; |
|---|
| 118 | GB_export_error(error); |
|---|
| 119 | } |
|---|
| 120 | } |
|---|
| 121 | } |
|---|
| 122 | return gb_gene; |
|---|
| 123 | } |
|---|
| 124 | |
|---|
| 125 | GBDATA* GEN_first_gene(GBDATA *gb_species) { |
|---|
| 126 | return GB_entry(GEN_expect_gene_data(gb_species), "gene"); |
|---|
| 127 | } |
|---|
| 128 | |
|---|
| 129 | GBDATA* GEN_first_gene_rel_gene_data(GBDATA *gb_gene_data) { |
|---|
| 130 | return GB_entry(gb_gene_data, "gene"); |
|---|
| 131 | } |
|---|
| 132 | |
|---|
| 133 | GBDATA* GEN_next_gene(GBDATA *gb_gene) { |
|---|
| 134 | gb_assert(GB_has_key(gb_gene, "gene")); |
|---|
| 135 | return GB_nextEntry(gb_gene); |
|---|
| 136 | } |
|---|
| 137 | |
|---|
| 138 | GBDATA *GEN_first_marked_gene(GBDATA *gb_species) { |
|---|
| 139 | return GB_first_marked(GEN_expect_gene_data(gb_species), "gene"); |
|---|
| 140 | } |
|---|
| 141 | GBDATA *GEN_next_marked_gene(GBDATA *gb_gene) { |
|---|
| 142 | return GB_next_marked(gb_gene, "gene"); |
|---|
| 143 | } |
|---|
| 144 | |
|---|
| 145 | // ---------------------- |
|---|
| 146 | // gene position |
|---|
| 147 | |
|---|
| 148 | static GEN_position *lastFreedPosition = 0; |
|---|
| 149 | |
|---|
| 150 | GEN_position *GEN_new_position(int parts, bool joinable) { |
|---|
| 151 | GEN_position *pos; |
|---|
| 152 | |
|---|
| 153 | size_t pos_size = parts*sizeof(pos->start_pos[0]); |
|---|
| 154 | size_t comp_size = parts*sizeof(pos->complement[0]); |
|---|
| 155 | size_t data_size = 2*pos_size+3*comp_size; |
|---|
| 156 | |
|---|
| 157 | gb_assert(parts>0); |
|---|
| 158 | |
|---|
| 159 | if (lastFreedPosition && lastFreedPosition->parts == parts) { |
|---|
| 160 | pos = lastFreedPosition; |
|---|
| 161 | lastFreedPosition = 0; |
|---|
| 162 | memset(pos->start_pos, 0, data_size); |
|---|
| 163 | } |
|---|
| 164 | else { |
|---|
| 165 | pos = (GEN_position*)GB_calloc(1, sizeof(*pos)); |
|---|
| 166 | pos->parts = parts; |
|---|
| 167 | pos->start_pos = (size_t*)GB_calloc(1, data_size); |
|---|
| 168 | pos->stop_pos = pos->start_pos+parts; |
|---|
| 169 | pos->complement = (unsigned char*)(pos->stop_pos+parts); |
|---|
| 170 | } |
|---|
| 171 | |
|---|
| 172 | pos->joinable = joinable; |
|---|
| 173 | pos->start_uncertain = 0; |
|---|
| 174 | pos->stop_uncertain = 0; |
|---|
| 175 | |
|---|
| 176 | return pos; |
|---|
| 177 | } |
|---|
| 178 | |
|---|
| 179 | void GEN_use_uncertainties(GEN_position *pos) { |
|---|
| 180 | if (pos->start_uncertain == 0) { |
|---|
| 181 | // space was already allocated in GEN_new_position |
|---|
| 182 | pos->start_uncertain = pos->complement+pos->parts; |
|---|
| 183 | pos->stop_uncertain = pos->start_uncertain+pos->parts; |
|---|
| 184 | |
|---|
| 185 | size_t comp_size = pos->parts*sizeof(pos->complement[0]); |
|---|
| 186 | memset(pos->start_uncertain, '=', 2*comp_size); |
|---|
| 187 | } |
|---|
| 188 | } |
|---|
| 189 | |
|---|
| 190 | void GEN_free_position(GEN_position *pos) { |
|---|
| 191 | if (pos) { |
|---|
| 192 | if (lastFreedPosition) { |
|---|
| 193 | free(lastFreedPosition->start_pos); // rest is allocated together with start_pos |
|---|
| 194 | free(lastFreedPosition); |
|---|
| 195 | } |
|---|
| 196 | |
|---|
| 197 | lastFreedPosition = pos; |
|---|
| 198 | } |
|---|
| 199 | } |
|---|
| 200 | |
|---|
| 201 | static struct GEN_position_mem_handler { |
|---|
| 202 | ~GEN_position_mem_handler() { GEN_free_position(NULL); } |
|---|
| 203 | } GEN_position_dealloc; |
|---|
| 204 | |
|---|
| 205 | |
|---|
| 206 | static GB_ERROR parseCSV(GBDATA *gb_gene, const char *field_name, size_t parts_expected, ConstStrArray& parseTable) { |
|---|
| 207 | // reads a field and splits the content at ',' |
|---|
| 208 | // results are stored in parseTable |
|---|
| 209 | |
|---|
| 210 | GB_ERROR error = 0; |
|---|
| 211 | GBDATA *gb_field = GB_entry(gb_gene, field_name); |
|---|
| 212 | if (!gb_field) error = GBS_global_string("Expected entry '%s' missing", field_name); |
|---|
| 213 | else { |
|---|
| 214 | char *content = GB_read_string(gb_field); |
|---|
| 215 | if (!content) error = GB_await_error(); |
|---|
| 216 | else { |
|---|
| 217 | parseTable.erase(); |
|---|
| 218 | GBT_splitNdestroy_string(parseTable, content, ','); |
|---|
| 219 | if (parseTable.size() != parts_expected) { |
|---|
| 220 | error = GBS_global_string("Expected %zu CSV, found %zu", parts_expected, parseTable.size()); |
|---|
| 221 | } |
|---|
| 222 | } |
|---|
| 223 | } |
|---|
| 224 | return error; |
|---|
| 225 | } |
|---|
| 226 | |
|---|
| 227 | static GB_ERROR parsePositions(GBDATA *gb_gene, const char *field_name, int parts_expected, size_t *results, ConstStrArray& parseTable) { |
|---|
| 228 | GB_ERROR error = parseCSV(gb_gene, field_name, parts_expected, parseTable); |
|---|
| 229 | if (!error) { |
|---|
| 230 | int p; |
|---|
| 231 | for (p = 0; p<parts_expected && !error; p++) { |
|---|
| 232 | char *end; |
|---|
| 233 | results[p] = strtol(parseTable[p], &end, 10); |
|---|
| 234 | if (end == parseTable[p]) { // error |
|---|
| 235 | error = GBS_global_string("can't convert '%s' to number", parseTable[p]); |
|---|
| 236 | } |
|---|
| 237 | } |
|---|
| 238 | } |
|---|
| 239 | if (error) { |
|---|
| 240 | error = GBS_global_string("While parsing field '%s': %s", field_name, error); |
|---|
| 241 | } |
|---|
| 242 | return error; |
|---|
| 243 | } |
|---|
| 244 | |
|---|
| 245 | GEN_position *GEN_read_position(GBDATA *gb_gene) { |
|---|
| 246 | int parts = 1; |
|---|
| 247 | bool joinable = false; |
|---|
| 248 | GBDATA *gb_pos_joined = GB_entry(gb_gene, "pos_joined"); |
|---|
| 249 | GEN_position *pos = 0; |
|---|
| 250 | GB_ERROR error = 0; |
|---|
| 251 | |
|---|
| 252 | if (gb_pos_joined) { |
|---|
| 253 | parts = GB_read_int(gb_pos_joined); |
|---|
| 254 | if (parts != 1) { // splitted |
|---|
| 255 | if (parts>1) joinable = true; |
|---|
| 256 | else if (parts<-1) parts = -parts; // neg value means "not joinable" (comes from feature location 'order(...)') |
|---|
| 257 | else error = GBS_global_string("Illegal value %i in 'pos_joined'", parts); |
|---|
| 258 | } |
|---|
| 259 | } |
|---|
| 260 | |
|---|
| 261 | if (!error) { |
|---|
| 262 | pos = GEN_new_position(parts, joinable); |
|---|
| 263 | |
|---|
| 264 | ConstStrArray parseTable; |
|---|
| 265 | parseTable.reserve(parts); |
|---|
| 266 | |
|---|
| 267 | error = parsePositions(gb_gene, "pos_start", parts, pos->start_pos, parseTable); |
|---|
| 268 | if (!error) error = parsePositions(gb_gene, "pos_stop", parts, pos->stop_pos, parseTable); |
|---|
| 269 | |
|---|
| 270 | int p; |
|---|
| 271 | if (!error) { |
|---|
| 272 | error = parseCSV(gb_gene, "pos_complement", parts, parseTable); |
|---|
| 273 | for (p = 0; p<parts && !error; p++) { |
|---|
| 274 | const char *val = parseTable[p]; |
|---|
| 275 | if ((val[0] != '0' && val[0] != '1') || val[1] != 0) { |
|---|
| 276 | error = GBS_global_string("Invalid content '%s' in 'pos_complement' (expected: \"01\")", val); |
|---|
| 277 | } |
|---|
| 278 | else { |
|---|
| 279 | pos->complement[p] = (unsigned char)atoi(val); |
|---|
| 280 | } |
|---|
| 281 | } |
|---|
| 282 | } |
|---|
| 283 | |
|---|
| 284 | if (!error) { |
|---|
| 285 | GBDATA *gb_pos_certain = GB_entry(gb_gene, "pos_certain"); |
|---|
| 286 | |
|---|
| 287 | if (gb_pos_certain) { |
|---|
| 288 | error = parseCSV(gb_gene, "pos_certain", parts, parseTable); |
|---|
| 289 | GEN_use_uncertainties(pos); |
|---|
| 290 | for (p = 0; p<parts && !error; p++) { |
|---|
| 291 | const unsigned char *val = (unsigned char *)(parseTable[p]); |
|---|
| 292 | int vp; |
|---|
| 293 | |
|---|
| 294 | for (vp = 0; vp<2; vp++) { |
|---|
| 295 | unsigned char c = val[vp]; |
|---|
| 296 | if (c != '<' && c != '=' && c != '>' && (c != "+-"[vp])) { |
|---|
| 297 | error = GBS_global_string("Invalid content '%s' in 'pos_certain' (expected 2 from \"<=>\")", val); |
|---|
| 298 | } |
|---|
| 299 | } |
|---|
| 300 | if (!error) { |
|---|
| 301 | pos->start_uncertain[p] = val[0]; |
|---|
| 302 | pos->stop_uncertain[p] = val[1]; |
|---|
| 303 | } |
|---|
| 304 | } |
|---|
| 305 | } |
|---|
| 306 | } |
|---|
| 307 | } |
|---|
| 308 | |
|---|
| 309 | gb_assert(error || pos); |
|---|
| 310 | if (error) { |
|---|
| 311 | GB_export_error(error); |
|---|
| 312 | if (pos) { |
|---|
| 313 | GEN_free_position(pos); |
|---|
| 314 | pos = 0; |
|---|
| 315 | } |
|---|
| 316 | } |
|---|
| 317 | return pos; |
|---|
| 318 | } |
|---|
| 319 | |
|---|
| 320 | GB_ERROR GEN_write_position(GBDATA *gb_gene, const GEN_position *pos, long seqLength) { |
|---|
| 321 | // if 'seqLength' is != 0, it is used to check the correctness of 'pos' |
|---|
| 322 | // (otherwise this function reads the genome-sequence to detect its length) |
|---|
| 323 | |
|---|
| 324 | GB_ERROR error = 0; |
|---|
| 325 | GBDATA *gb_pos_joined = GB_entry(gb_gene, "pos_joined"); |
|---|
| 326 | GBDATA *gb_pos_certain = GB_entry(gb_gene, "pos_certain"); |
|---|
| 327 | GBDATA *gb_pos_start; |
|---|
| 328 | GBDATA *gb_pos_stop; |
|---|
| 329 | GBDATA *gb_pos_complement; |
|---|
| 330 | int p; |
|---|
| 331 | |
|---|
| 332 | gb_assert(pos); |
|---|
| 333 | |
|---|
| 334 | gb_pos_start = GB_search(gb_gene, "pos_start", GB_STRING); |
|---|
| 335 | if (!gb_pos_start) error = GB_await_error(); |
|---|
| 336 | |
|---|
| 337 | if (!error) { |
|---|
| 338 | gb_pos_stop = GB_search(gb_gene, "pos_stop", GB_STRING); |
|---|
| 339 | if (!gb_pos_stop) error = GB_await_error(); |
|---|
| 340 | } |
|---|
| 341 | if (!error) { |
|---|
| 342 | gb_pos_complement = GB_search(gb_gene, "pos_complement", GB_STRING); |
|---|
| 343 | if (!gb_pos_complement) error = GB_await_error(); |
|---|
| 344 | } |
|---|
| 345 | |
|---|
| 346 | if (!error) { |
|---|
| 347 | if (pos->start_uncertain) { |
|---|
| 348 | if (!gb_pos_certain) { |
|---|
| 349 | gb_pos_certain = GB_search(gb_gene, "pos_certain", GB_STRING); |
|---|
| 350 | if (!gb_pos_certain) error = GB_await_error(); |
|---|
| 351 | } |
|---|
| 352 | } |
|---|
| 353 | else { |
|---|
| 354 | if (gb_pos_certain) { |
|---|
| 355 | error = GB_delete(gb_pos_certain); |
|---|
| 356 | gb_pos_certain = 0; |
|---|
| 357 | } |
|---|
| 358 | } |
|---|
| 359 | } |
|---|
| 360 | |
|---|
| 361 | // test data |
|---|
| 362 | if (!error) { |
|---|
| 363 | size_t length; |
|---|
| 364 | |
|---|
| 365 | if (seqLength) { |
|---|
| 366 | length = seqLength; |
|---|
| 367 | } |
|---|
| 368 | else { // unknown -> autodetect |
|---|
| 369 | GBDATA *gb_organism = GB_get_grandfather(gb_gene); |
|---|
| 370 | GBDATA *gb_genome = GBT_read_sequence(gb_organism, GENOM_ALIGNMENT); |
|---|
| 371 | |
|---|
| 372 | length = GB_read_count(gb_genome); |
|---|
| 373 | } |
|---|
| 374 | |
|---|
| 375 | for (p = 0; p<pos->parts && !error; ++p) { |
|---|
| 376 | char c; |
|---|
| 377 | |
|---|
| 378 | c = pos->complement[p]; gb_assert(c == 0 || c == 1); |
|---|
| 379 | if (c<0 || c>1) { |
|---|
| 380 | error = GBS_global_string("Illegal value %i in complement", int(c)); |
|---|
| 381 | } |
|---|
| 382 | else { |
|---|
| 383 | if (pos->start_pos[p]>pos->stop_pos[p]) { |
|---|
| 384 | error = GBS_global_string("Illegal positions (%zu>%zu)", pos->start_pos[p], pos->stop_pos[p]); |
|---|
| 385 | } |
|---|
| 386 | else if (pos->start_pos[p] == 0) { |
|---|
| 387 | error = GBS_global_string("Illegal start position %zu", pos->start_pos[p]); |
|---|
| 388 | } |
|---|
| 389 | else if (pos->stop_pos[p] > length) { |
|---|
| 390 | error = GBS_global_string("Illegal stop position %zu (>length(=%zu))", pos->stop_pos[p], length); |
|---|
| 391 | } |
|---|
| 392 | else { |
|---|
| 393 | if (pos->start_uncertain) { |
|---|
| 394 | c = pos->start_uncertain[p]; |
|---|
| 395 | char c2 = pos->stop_uncertain[p]; |
|---|
| 396 | |
|---|
| 397 | if (!c || strchr("<=>+", c) == 0) error = GBS_global_string("Invalid uncertainty '%c'", c); |
|---|
| 398 | else if (!c2 || strchr("<=>-", c2) == 0) error = GBS_global_string("Invalid uncertainty '%c'", c2); |
|---|
| 399 | else { |
|---|
| 400 | if (c == '+' || c2 == '-') { |
|---|
| 401 | if (c == '+' && c2 == '-') { |
|---|
| 402 | if (pos->start_pos[p] != pos->stop_pos[p]-1) { |
|---|
| 403 | error = GBS_global_string("Invalid positions %zu^%zu for uncertainties +-", pos->start_pos[p], pos->stop_pos[p]); |
|---|
| 404 | } |
|---|
| 405 | } |
|---|
| 406 | else { |
|---|
| 407 | error = "uncertainties '+' and '-' can only be used together"; |
|---|
| 408 | } |
|---|
| 409 | } |
|---|
| 410 | } |
|---|
| 411 | } |
|---|
| 412 | } |
|---|
| 413 | } |
|---|
| 414 | } |
|---|
| 415 | } |
|---|
| 416 | |
|---|
| 417 | if (!error) { |
|---|
| 418 | if (pos->parts == 1) { |
|---|
| 419 | if (gb_pos_joined) error = GB_delete(gb_pos_joined); |
|---|
| 420 | |
|---|
| 421 | if (!error) error = GB_write_string(gb_pos_start, GBS_global_string("%zu", pos->start_pos[0])); |
|---|
| 422 | if (!error) error = GB_write_string(gb_pos_stop, GBS_global_string("%zu", pos->stop_pos[0])); |
|---|
| 423 | if (!error) error = GB_write_string(gb_pos_complement, GBS_global_string("%c", pos->complement[0]+'0')); |
|---|
| 424 | |
|---|
| 425 | if (!error && gb_pos_certain) { |
|---|
| 426 | error = GB_write_string(gb_pos_certain, GBS_global_string("%c%c", pos->start_uncertain[0], pos->stop_uncertain[0])); |
|---|
| 427 | } |
|---|
| 428 | } |
|---|
| 429 | else { |
|---|
| 430 | if (!gb_pos_joined) { |
|---|
| 431 | gb_pos_joined = GB_search(gb_gene, "pos_joined", GB_INT); |
|---|
| 432 | if (!gb_pos_joined) error = GB_await_error(); |
|---|
| 433 | } |
|---|
| 434 | if (!error) error = GB_write_int(gb_pos_joined, pos->parts * (pos->joinable ? 1 : -1)); // neg. parts means not joinable |
|---|
| 435 | |
|---|
| 436 | if (!error) { |
|---|
| 437 | GBS_strstruct *start = GBS_stropen(12*pos->parts); |
|---|
| 438 | GBS_strstruct *stop = GBS_stropen(12*pos->parts); |
|---|
| 439 | GBS_strstruct *complement = GBS_stropen(2*pos->parts); |
|---|
| 440 | GBS_strstruct *uncertain = GBS_stropen(3*pos->parts); |
|---|
| 441 | |
|---|
| 442 | for (p = 0; p<pos->parts; ++p) { |
|---|
| 443 | if (p>0) { |
|---|
| 444 | GBS_chrcat(start, ','); |
|---|
| 445 | GBS_chrcat(stop, ','); |
|---|
| 446 | GBS_chrcat(complement, ','); |
|---|
| 447 | GBS_chrcat(uncertain, ','); |
|---|
| 448 | } |
|---|
| 449 | GBS_strcat(start, GBS_global_string("%zu", pos->start_pos[p])); |
|---|
| 450 | GBS_strcat(stop, GBS_global_string("%zu", pos->stop_pos[p])); |
|---|
| 451 | GBS_chrcat(complement, pos->complement[p]+'0'); |
|---|
| 452 | if (gb_pos_certain) { |
|---|
| 453 | GBS_chrcat(uncertain, pos->start_uncertain[p]); |
|---|
| 454 | GBS_chrcat(uncertain, pos->stop_uncertain[p]); |
|---|
| 455 | } |
|---|
| 456 | } |
|---|
| 457 | |
|---|
| 458 | char *sstart = GBS_strclose(start); |
|---|
| 459 | char *sstop = GBS_strclose(stop); |
|---|
| 460 | char *scomplement = GBS_strclose(complement); |
|---|
| 461 | char *suncertain = GBS_strclose(uncertain); |
|---|
| 462 | |
|---|
| 463 | error = GB_write_string(gb_pos_start, sstart); |
|---|
| 464 | if (!error) error = GB_write_string(gb_pos_stop, sstop); |
|---|
| 465 | if (!error) error = GB_write_string(gb_pos_complement, scomplement); |
|---|
| 466 | if (!error && gb_pos_certain) error = GB_write_string(gb_pos_certain, suncertain); |
|---|
| 467 | |
|---|
| 468 | free(suncertain); |
|---|
| 469 | free(scomplement); |
|---|
| 470 | free(sstop); |
|---|
| 471 | free(sstart); |
|---|
| 472 | } |
|---|
| 473 | } |
|---|
| 474 | } |
|---|
| 475 | |
|---|
| 476 | return error; |
|---|
| 477 | } |
|---|
| 478 | |
|---|
| 479 | static GEN_position *location2sort = 0; |
|---|
| 480 | |
|---|
| 481 | static int cmp_location_parts(const void *v1, const void *v2) { |
|---|
| 482 | int i1 = *(int*)v1; |
|---|
| 483 | int i2 = *(int*)v2; |
|---|
| 484 | |
|---|
| 485 | int cmp = location2sort->start_pos[i1]-location2sort->start_pos[i2]; |
|---|
| 486 | if (!cmp) { |
|---|
| 487 | cmp = location2sort->stop_pos[i1]-location2sort->stop_pos[i2]; |
|---|
| 488 | } |
|---|
| 489 | return cmp; |
|---|
| 490 | } |
|---|
| 491 | |
|---|
| 492 | void GEN_sortAndMergeLocationParts(GEN_position *location) { |
|---|
| 493 | // Note: makes location partly invalid (only start_pos + stop_pos are valid afterwards) |
|---|
| 494 | int parts = location->parts; |
|---|
| 495 | int *idx = (int*)malloc(parts*sizeof(*idx)); // idx[newpos] = oldpos |
|---|
| 496 | int i, p; |
|---|
| 497 | |
|---|
| 498 | for (p = 0; p<parts; ++p) idx[p] = p; |
|---|
| 499 | |
|---|
| 500 | location2sort = location; |
|---|
| 501 | qsort(idx, parts, sizeof(*idx), cmp_location_parts); |
|---|
| 502 | location2sort = 0; |
|---|
| 503 | |
|---|
| 504 | for (p = 0; p<parts; ++p) { |
|---|
| 505 | i = idx[p]; |
|---|
| 506 | |
|---|
| 507 | #define swap(a, b, type) do { type tmp = (a); (a) = (b); (b) = (tmp); } while (0) |
|---|
| 508 | |
|---|
| 509 | if (i != p) { |
|---|
| 510 | swap(location->start_pos[i], location->start_pos[p], size_t); |
|---|
| 511 | swap(location->stop_pos[i], location->stop_pos[p], size_t); |
|---|
| 512 | swap(idx[i], idx[p], int); |
|---|
| 513 | } |
|---|
| 514 | } |
|---|
| 515 | |
|---|
| 516 | #if defined(DEBUG) && 0 |
|---|
| 517 | printf("Locations sorted:\n"); |
|---|
| 518 | for (p = 0; p<parts; ++p) { |
|---|
| 519 | printf(" [%i] %i - %i %i\n", p, location->start_pos[p], location->stop_pos[p], (int)(location->complement[p])); |
|---|
| 520 | } |
|---|
| 521 | #endif // DEBUG |
|---|
| 522 | |
|---|
| 523 | i = 0; |
|---|
| 524 | for (p = 1; p<parts; p++) { |
|---|
| 525 | if ((location->stop_pos[i]+1) >= location->start_pos[p]) { |
|---|
| 526 | // parts overlap or are directly consecutive |
|---|
| 527 | |
|---|
| 528 | location->stop_pos[i] = location->stop_pos[p]; |
|---|
| 529 | } |
|---|
| 530 | else { |
|---|
| 531 | i++; |
|---|
| 532 | location->start_pos[i] = location->start_pos[p]; |
|---|
| 533 | location->stop_pos[i] = location->stop_pos[p]; |
|---|
| 534 | } |
|---|
| 535 | } |
|---|
| 536 | location->parts = i+1; |
|---|
| 537 | |
|---|
| 538 | #if defined(DEBUG) && 0 |
|---|
| 539 | parts = location->parts; |
|---|
| 540 | printf("Locations merged:\n"); |
|---|
| 541 | for (p = 0; p<parts; ++p) { |
|---|
| 542 | printf(" [%i] %i - %i %i\n", p, location->start_pos[p], location->stop_pos[p], (int)(location->complement[p])); |
|---|
| 543 | } |
|---|
| 544 | #endif // DEBUG |
|---|
| 545 | |
|---|
| 546 | free(idx); |
|---|
| 547 | } |
|---|
| 548 | |
|---|
| 549 | |
|---|
| 550 | |
|---|
| 551 | // ----------------------------------------- |
|---|
| 552 | // test if species is pseudo-species |
|---|
| 553 | |
|---|
| 554 | const char *GEN_origin_organism(GBDATA *gb_pseudo) { |
|---|
| 555 | GBDATA *gb_origin = GB_entry(gb_pseudo, "ARB_origin_species"); |
|---|
| 556 | return gb_origin ? GB_read_char_pntr(gb_origin) : 0; |
|---|
| 557 | } |
|---|
| 558 | const char *GEN_origin_gene(GBDATA *gb_pseudo) { |
|---|
| 559 | GBDATA *gb_origin = GB_entry(gb_pseudo, "ARB_origin_gene"); |
|---|
| 560 | return gb_origin ? GB_read_char_pntr(gb_origin) : 0; |
|---|
| 561 | } |
|---|
| 562 | |
|---|
| 563 | bool GEN_is_pseudo_gene_species(GBDATA *gb_species) { |
|---|
| 564 | return GEN_origin_organism(gb_species) != 0; |
|---|
| 565 | } |
|---|
| 566 | |
|---|
| 567 | // ------------------------------------------------ |
|---|
| 568 | // find organism or gene for pseudo-species |
|---|
| 569 | |
|---|
| 570 | GB_ERROR GEN_organism_not_found(GBDATA *gb_pseudo) { |
|---|
| 571 | gb_assert(GEN_is_pseudo_gene_species(gb_pseudo)); |
|---|
| 572 | gb_assert(GEN_find_origin_organism(gb_pseudo, 0) == 0); |
|---|
| 573 | |
|---|
| 574 | return GB_export_errorf("The gene-species '%s' refers to an unknown organism (%s)\n" |
|---|
| 575 | "This occurs if you rename or delete the organism or change the entry\n" |
|---|
| 576 | "'ARB_origin_species' and will most likely cause serious problems.", |
|---|
| 577 | GBT_read_name(gb_pseudo), |
|---|
| 578 | GEN_origin_organism(gb_pseudo)); |
|---|
| 579 | } |
|---|
| 580 | |
|---|
| 581 | // @@@ FIXME: missing: GEN_gene_not_found (like GEN_organism_not_found) |
|---|
| 582 | |
|---|
| 583 | // ------------------------------ |
|---|
| 584 | // search pseudo species |
|---|
| 585 | |
|---|
| 586 | static const char *pseudo_species_hash_key(const char *organism_name, const char *gene_name) { |
|---|
| 587 | return GBS_global_string("%s*%s", organism_name, gene_name); |
|---|
| 588 | } |
|---|
| 589 | |
|---|
| 590 | static GBDATA *GEN_read_pseudo_species_from_hash(const GB_HASH *pseudo_hash, const char *organism_name, const char *gene_name) { |
|---|
| 591 | return (GBDATA*)GBS_read_hash(pseudo_hash, pseudo_species_hash_key(organism_name, gene_name)); |
|---|
| 592 | } |
|---|
| 593 | |
|---|
| 594 | void GEN_add_pseudo_species_to_hash(GBDATA *gb_pseudo, GB_HASH *pseudo_hash) { |
|---|
| 595 | const char *organism_name = GEN_origin_organism(gb_pseudo); |
|---|
| 596 | const char *gene_name = GEN_origin_gene(gb_pseudo); |
|---|
| 597 | |
|---|
| 598 | gb_assert(organism_name); |
|---|
| 599 | gb_assert(gene_name); |
|---|
| 600 | |
|---|
| 601 | GBS_write_hash(pseudo_hash, pseudo_species_hash_key(organism_name, gene_name), (long)gb_pseudo); |
|---|
| 602 | } |
|---|
| 603 | |
|---|
| 604 | GB_HASH *GEN_create_pseudo_species_hash(GBDATA *gb_main, int additionalSize) { |
|---|
| 605 | GB_HASH *pseudo_hash = GBS_create_hash(GBT_get_species_count(gb_main)+additionalSize, GB_IGNORE_CASE); |
|---|
| 606 | GBDATA *gb_pseudo; |
|---|
| 607 | |
|---|
| 608 | for (gb_pseudo = GEN_first_pseudo_species(gb_main); |
|---|
| 609 | gb_pseudo; |
|---|
| 610 | gb_pseudo = GEN_next_pseudo_species(gb_pseudo)) |
|---|
| 611 | { |
|---|
| 612 | GEN_add_pseudo_species_to_hash(gb_pseudo, pseudo_hash); |
|---|
| 613 | } |
|---|
| 614 | |
|---|
| 615 | return pseudo_hash; |
|---|
| 616 | } |
|---|
| 617 | |
|---|
| 618 | GBDATA *GEN_find_pseudo_species(GBDATA *gb_main, const char *organism_name, const char *gene_name, const GB_HASH *pseudo_hash) { |
|---|
| 619 | // parameter pseudo_hash : |
|---|
| 620 | // 0 -> use slow direct search [if you only search one] |
|---|
| 621 | // otherwise it shall be a hash generated by GEN_create_pseudo_species_hash() [if you search several times] |
|---|
| 622 | // Note : use GEN_add_pseudo_species_to_hash to keep hash up-to-date |
|---|
| 623 | GBDATA *gb_pseudo; |
|---|
| 624 | |
|---|
| 625 | if (pseudo_hash) { |
|---|
| 626 | gb_pseudo = GEN_read_pseudo_species_from_hash(pseudo_hash, organism_name, gene_name); |
|---|
| 627 | } |
|---|
| 628 | else { |
|---|
| 629 | for (gb_pseudo = GEN_first_pseudo_species(gb_main); |
|---|
| 630 | gb_pseudo; |
|---|
| 631 | gb_pseudo = GEN_next_pseudo_species(gb_pseudo)) |
|---|
| 632 | { |
|---|
| 633 | const char *origin_gene_name = GEN_origin_gene(gb_pseudo); |
|---|
| 634 | if (strcmp(gene_name, origin_gene_name) == 0) { |
|---|
| 635 | const char *origin_species_name = GEN_origin_organism(gb_pseudo); |
|---|
| 636 | if (strcmp(organism_name, origin_species_name) == 0) { |
|---|
| 637 | break; // found pseudo species |
|---|
| 638 | } |
|---|
| 639 | } |
|---|
| 640 | } |
|---|
| 641 | } |
|---|
| 642 | return gb_pseudo; |
|---|
| 643 | } |
|---|
| 644 | |
|---|
| 645 | // ----------------------- |
|---|
| 646 | // search origins |
|---|
| 647 | |
|---|
| 648 | GBDATA *GEN_find_origin_organism(GBDATA *gb_pseudo, const GB_HASH *organism_hash) { |
|---|
| 649 | // parameter organism_hash: |
|---|
| 650 | // 0 -> use slow direct search [if you only search one or two] |
|---|
| 651 | // otherwise it shall be a hash generated by GBT_create_organism_hash() [if you search several times] |
|---|
| 652 | // Note : use GBT_add_item_to_hash() to keep hash up-to-date |
|---|
| 653 | |
|---|
| 654 | const char *origin_species_name; |
|---|
| 655 | GBDATA *gb_organism = 0; |
|---|
| 656 | gb_assert(GEN_is_pseudo_gene_species(gb_pseudo)); |
|---|
| 657 | |
|---|
| 658 | origin_species_name = GEN_origin_organism(gb_pseudo); |
|---|
| 659 | if (origin_species_name) { |
|---|
| 660 | if (organism_hash) { |
|---|
| 661 | gb_organism = (GBDATA*)GBS_read_hash(organism_hash, origin_species_name); |
|---|
| 662 | } |
|---|
| 663 | else { |
|---|
| 664 | gb_organism = GBT_find_species_rel_species_data(GB_get_father(gb_pseudo), origin_species_name); |
|---|
| 665 | } |
|---|
| 666 | } |
|---|
| 667 | |
|---|
| 668 | return gb_organism; |
|---|
| 669 | } |
|---|
| 670 | |
|---|
| 671 | GBDATA *GEN_find_origin_gene(GBDATA *gb_pseudo, const GB_HASH *organism_hash) { |
|---|
| 672 | const char *origin_gene_name; |
|---|
| 673 | |
|---|
| 674 | gb_assert(GEN_is_pseudo_gene_species(gb_pseudo)); |
|---|
| 675 | |
|---|
| 676 | origin_gene_name = GEN_origin_gene(gb_pseudo); |
|---|
| 677 | if (origin_gene_name) { |
|---|
| 678 | GBDATA *gb_organism = GEN_find_origin_organism(gb_pseudo, organism_hash); |
|---|
| 679 | gb_assert(gb_organism); |
|---|
| 680 | |
|---|
| 681 | return GEN_find_gene(gb_organism, origin_gene_name); |
|---|
| 682 | } |
|---|
| 683 | return 0; |
|---|
| 684 | } |
|---|
| 685 | |
|---|
| 686 | // -------------------------------- |
|---|
| 687 | // find pseudo-species |
|---|
| 688 | |
|---|
| 689 | GBDATA* GEN_first_pseudo_species(GBDATA *gb_main) { |
|---|
| 690 | GBDATA *gb_species = GBT_first_species(gb_main); |
|---|
| 691 | |
|---|
| 692 | if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) return gb_species; |
|---|
| 693 | return GEN_next_pseudo_species(gb_species); |
|---|
| 694 | } |
|---|
| 695 | |
|---|
| 696 | GBDATA* GEN_next_pseudo_species(GBDATA *gb_species) { |
|---|
| 697 | if (gb_species) { |
|---|
| 698 | while (1) { |
|---|
| 699 | gb_species = GBT_next_species(gb_species); |
|---|
| 700 | if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) break; |
|---|
| 701 | } |
|---|
| 702 | } |
|---|
| 703 | return gb_species; |
|---|
| 704 | } |
|---|
| 705 | |
|---|
| 706 | static GBDATA* GEN_next_marked_pseudo_species(GBDATA *gb_species) { |
|---|
| 707 | if (gb_species) { |
|---|
| 708 | while (1) { |
|---|
| 709 | gb_species = GBT_next_marked_species(gb_species); |
|---|
| 710 | if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) break; |
|---|
| 711 | } |
|---|
| 712 | } |
|---|
| 713 | return gb_species; |
|---|
| 714 | } |
|---|
| 715 | |
|---|
| 716 | GBDATA *GEN_first_marked_pseudo_species(GBDATA *gb_main) { |
|---|
| 717 | GBDATA *gb_species = GBT_first_marked_species(gb_main); |
|---|
| 718 | |
|---|
| 719 | if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) return gb_species; |
|---|
| 720 | return GEN_next_marked_pseudo_species(gb_species); |
|---|
| 721 | } |
|---|
| 722 | |
|---|
| 723 | // ------------------ |
|---|
| 724 | // organisms |
|---|
| 725 | |
|---|
| 726 | bool GEN_is_organism(GBDATA *gb_species) { |
|---|
| 727 | gb_assert(GEN_is_genome_db(GB_get_root(gb_species), -1)); // assert this is a genome db |
|---|
| 728 | // otherwise it is an error to use GEN_is_organism (or its callers)!!!! |
|---|
| 729 | |
|---|
| 730 | return GB_entry(gb_species, GENOM_ALIGNMENT) != 0; |
|---|
| 731 | } |
|---|
| 732 | |
|---|
| 733 | GBDATA *GEN_find_organism(GBDATA *gb_main, const char *name) { |
|---|
| 734 | GBDATA *gb_orga = GBT_find_species(gb_main, name); |
|---|
| 735 | if (gb_orga) { |
|---|
| 736 | if (!GEN_is_organism(gb_orga)) { |
|---|
| 737 | fprintf(stderr, "ARBDB-warning: found unspecific species named '%s', but expected an 'organism' with that name\n", name); |
|---|
| 738 | gb_orga = 0; |
|---|
| 739 | } |
|---|
| 740 | } |
|---|
| 741 | return gb_orga; |
|---|
| 742 | } |
|---|
| 743 | |
|---|
| 744 | GBDATA *GEN_first_organism(GBDATA *gb_main) { |
|---|
| 745 | GBDATA *gb_organism = GBT_first_species(gb_main); |
|---|
| 746 | |
|---|
| 747 | if (!gb_organism || GEN_is_organism(gb_organism)) return gb_organism; |
|---|
| 748 | return GEN_next_organism(gb_organism); |
|---|
| 749 | } |
|---|
| 750 | GBDATA *GEN_next_organism(GBDATA *gb_organism) { |
|---|
| 751 | if (gb_organism) { |
|---|
| 752 | while (1) { |
|---|
| 753 | gb_organism = GBT_next_species(gb_organism); |
|---|
| 754 | if (!gb_organism || GEN_is_organism(gb_organism)) break; |
|---|
| 755 | } |
|---|
| 756 | } |
|---|
| 757 | return gb_organism; |
|---|
| 758 | |
|---|
| 759 | } |
|---|
| 760 | |
|---|
| 761 | long GEN_get_organism_count(GBDATA *gb_main) { |
|---|
| 762 | long count = 0; |
|---|
| 763 | GBDATA *gb_organism = GEN_first_organism(gb_main); |
|---|
| 764 | while (gb_organism) { |
|---|
| 765 | count++; |
|---|
| 766 | gb_organism = GEN_next_organism(gb_organism); |
|---|
| 767 | } |
|---|
| 768 | return count; |
|---|
| 769 | } |
|---|
| 770 | |
|---|
| 771 | |
|---|
| 772 | GBDATA *GEN_first_marked_organism(GBDATA *gb_main) { |
|---|
| 773 | GBDATA *gb_organism = GBT_first_marked_species(gb_main); |
|---|
| 774 | |
|---|
| 775 | if (!gb_organism || GEN_is_organism(gb_organism)) return gb_organism; |
|---|
| 776 | return GEN_next_marked_organism(gb_organism); |
|---|
| 777 | } |
|---|
| 778 | GBDATA *GEN_next_marked_organism(GBDATA *gb_organism) { |
|---|
| 779 | if (gb_organism) { |
|---|
| 780 | while (1) { |
|---|
| 781 | gb_organism = GBT_next_marked_species(gb_organism); |
|---|
| 782 | if (!gb_organism || GEN_is_organism(gb_organism)) break; |
|---|
| 783 | } |
|---|
| 784 | } |
|---|
| 785 | return gb_organism; |
|---|
| 786 | } |
|---|
| 787 | |
|---|
| 788 | char *GEN_global_gene_identifier(GBDATA *gb_gene, GBDATA *gb_organism) { |
|---|
| 789 | if (!gb_organism) { |
|---|
| 790 | gb_organism = GB_get_grandfather(gb_gene); |
|---|
| 791 | gb_assert(gb_organism); |
|---|
| 792 | } |
|---|
| 793 | |
|---|
| 794 | return GBS_global_string_copy("%s/%s", GBT_read_name(gb_organism), GBT_read_name(gb_gene)); |
|---|
| 795 | } |
|---|
| 796 | |
|---|
| 797 | // -------------------------------------------------------------------------------- |
|---|
| 798 | |
|---|
| 799 | #ifdef UNIT_TESTS |
|---|
| 800 | #include <test_unit.h> |
|---|
| 801 | #include <arb_unit_test.h> |
|---|
| 802 | #include <arb_defs.h> |
|---|
| 803 | |
|---|
| 804 | static struct arb_unit_test::test_alignment_data TestAlignmentData_Genome[] = { |
|---|
| 805 | { 0, "spec", "AUCUCCUAAACCCAACCGUAGUUCGAAUUGAG" }, |
|---|
| 806 | }; |
|---|
| 807 | |
|---|
| 808 | #define TEST_EXPECT_MEMBER_EQUAL(s1,s2,member) TEST_EXPECT_EQUAL((s1)->member, (s2)->member) |
|---|
| 809 | |
|---|
| 810 | #define TEST_EXPECT_GENPOS_EQUAL(p1,p2) do { \ |
|---|
| 811 | TEST_EXPECT_MEMBER_EQUAL(p1, p2, parts); \ |
|---|
| 812 | TEST_EXPECT_MEMBER_EQUAL(p1, p2, joinable); \ |
|---|
| 813 | for (int p = 0; p<(p1)->parts; ++p) { \ |
|---|
| 814 | TEST_EXPECT_MEMBER_EQUAL(p1, p2, start_pos[p]); \ |
|---|
| 815 | TEST_EXPECT_MEMBER_EQUAL(p1, p2, stop_pos[p]); \ |
|---|
| 816 | TEST_EXPECT_MEMBER_EQUAL(p1, p2, complement[p]); \ |
|---|
| 817 | if ((p1)->start_uncertain) { \ |
|---|
| 818 | TEST_EXPECT_MEMBER_EQUAL(p1, p2, start_uncertain[p]); \ |
|---|
| 819 | TEST_EXPECT_MEMBER_EQUAL(p1, p2, stop_uncertain[p]); \ |
|---|
| 820 | } \ |
|---|
| 821 | } \ |
|---|
| 822 | } while(0) |
|---|
| 823 | |
|---|
| 824 | #define TEST_WRITE_READ_GEN_POSITION(pos) \ |
|---|
| 825 | do { \ |
|---|
| 826 | error = GEN_write_position(gb_gene, (pos), 0); \ |
|---|
| 827 | if (!error) { \ |
|---|
| 828 | GEN_position *rpos = GEN_read_position(gb_gene); \ |
|---|
| 829 | if (!rpos) { \ |
|---|
| 830 | error = GB_await_error(); \ |
|---|
| 831 | } \ |
|---|
| 832 | else { \ |
|---|
| 833 | TEST_EXPECT_GENPOS_EQUAL((pos), rpos); \ |
|---|
| 834 | GEN_free_position(rpos); \ |
|---|
| 835 | } \ |
|---|
| 836 | } \ |
|---|
| 837 | TEST_EXPECT_NULL(error.deliver()); \ |
|---|
| 838 | } while(0) |
|---|
| 839 | |
|---|
| 840 | #define TEST_WRITE_GEN_POSITION_ERROR(pos,exp_error) do { \ |
|---|
| 841 | error = GEN_write_position(gb_gene, &*(pos), 0); \ |
|---|
| 842 | TEST_EXPECT_EQUAL(error.deliver(), exp_error); \ |
|---|
| 843 | } while(0) |
|---|
| 844 | |
|---|
| 845 | #define TEST_GENPOS_FIELD(field,value) do { \ |
|---|
| 846 | GBDATA *gb_field = GB_entry(gb_gene, (field)); \ |
|---|
| 847 | if ((value)) { \ |
|---|
| 848 | TEST_REJECT_NULL(gb_field); \ |
|---|
| 849 | TEST_EXPECT_EQUAL(GB_read_char_pntr(gb_field), (value)); \ |
|---|
| 850 | } \ |
|---|
| 851 | else { \ |
|---|
| 852 | TEST_EXPECT_NULL(gb_field); \ |
|---|
| 853 | } \ |
|---|
| 854 | } while(0) |
|---|
| 855 | |
|---|
| 856 | #define TEST_GENPOS_FIELDS(start,stop,complement,certain) do { \ |
|---|
| 857 | TEST_GENPOS_FIELD("pos_start", start); \ |
|---|
| 858 | TEST_GENPOS_FIELD("pos_stop", stop); \ |
|---|
| 859 | TEST_GENPOS_FIELD("pos_complement", complement); \ |
|---|
| 860 | TEST_GENPOS_FIELD("pos_certain", certain); \ |
|---|
| 861 | } while(0) |
|---|
| 862 | |
|---|
| 863 | #define TEST_GENE_SEQ_AND_LENGTH(werr,wseq,wlen) do { \ |
|---|
| 864 | size_t len; \ |
|---|
| 865 | char *seq = GBT_read_gene_sequence_and_length(gb_gene, true, '-', &len); \ |
|---|
| 866 | TEST_EXPECT_EQUAL(GB_have_error(), werr); \ |
|---|
| 867 | if (seq) { \ |
|---|
| 868 | TEST_EXPECT_EQUAL(len, (size_t)(wlen)); \ |
|---|
| 869 | TEST_EXPECT_EQUAL(seq, (wseq)); \ |
|---|
| 870 | free(seq); \ |
|---|
| 871 | } \ |
|---|
| 872 | else { \ |
|---|
| 873 | GB_clear_error(); \ |
|---|
| 874 | } \ |
|---|
| 875 | } while(0) |
|---|
| 876 | |
|---|
| 877 | void TEST_GEN_position() { |
|---|
| 878 | // see also ../GENOM_IMPORT/Location.cxx@TEST_gene_location |
|---|
| 879 | |
|---|
| 880 | GB_shell shell; |
|---|
| 881 | ARB_ERROR error; |
|---|
| 882 | GBDATA *gb_main = TEST_CREATE_DB(error, "ali_genom", TestAlignmentData_Genome, false); |
|---|
| 883 | |
|---|
| 884 | TEST_EXPECT_NULL(error.deliver()); |
|---|
| 885 | |
|---|
| 886 | { |
|---|
| 887 | GB_transaction ta(gb_main); |
|---|
| 888 | |
|---|
| 889 | GBDATA *gb_organism = GBT_find_species(gb_main, "spec"); TEST_REJECT_NULL(gb_organism); |
|---|
| 890 | GBDATA *gb_gene_data = GEN_findOrCreate_gene_data(gb_organism); TEST_REJECT_NULL(gb_gene_data); |
|---|
| 891 | GBDATA *gb_gene = GEN_create_nonexisting_gene_rel_gene_data(gb_gene_data, "gene"); TEST_REJECT_NULL(gb_gene); |
|---|
| 892 | |
|---|
| 893 | typedef SmartCustomPtr(GEN_position, GEN_free_position) GEN_position_Ptr; |
|---|
| 894 | GEN_position_Ptr pos; |
|---|
| 895 | |
|---|
| 896 | pos = GEN_new_position(1, false); |
|---|
| 897 | |
|---|
| 898 | TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal start position 0"); |
|---|
| 899 | |
|---|
| 900 | pos->start_pos[0] = 5; |
|---|
| 901 | pos->stop_pos[0] = 10; |
|---|
| 902 | pos->complement[0] = 1; |
|---|
| 903 | |
|---|
| 904 | GEN_use_uncertainties(&*pos); |
|---|
| 905 | |
|---|
| 906 | TEST_WRITE_READ_GEN_POSITION(&*pos); |
|---|
| 907 | TEST_GENPOS_FIELDS("5", "10", "1", "=="); |
|---|
| 908 | |
|---|
| 909 | TEST_GENE_SEQ_AND_LENGTH(false, "TTTAGG", 6); |
|---|
| 910 | |
|---|
| 911 | // ---------- |
|---|
| 912 | |
|---|
| 913 | pos = GEN_new_position(3, false); |
|---|
| 914 | |
|---|
| 915 | TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal start position 0"); |
|---|
| 916 | |
|---|
| 917 | GEN_use_uncertainties(&*pos); |
|---|
| 918 | |
|---|
| 919 | pos->start_pos[0] = 5; pos->start_pos[1] = 10; pos->start_pos[2] = 25; |
|---|
| 920 | pos->stop_pos[0] = 15; pos->stop_pos[1] = 20; pos->stop_pos[2] = 25; |
|---|
| 921 | pos->complement[0] = 0; pos->complement[1] = 1; pos->complement[2] = 0; |
|---|
| 922 | |
|---|
| 923 | pos->start_uncertain[0] = '<'; |
|---|
| 924 | pos->stop_uncertain[2] = '>'; |
|---|
| 925 | |
|---|
| 926 | TEST_WRITE_READ_GEN_POSITION(&*pos); |
|---|
| 927 | TEST_GENPOS_FIELDS("5,10,25", "15,20,25", "0,1,0", "<=,==,=>"); |
|---|
| 928 | |
|---|
| 929 | TEST_GENE_SEQ_AND_LENGTH(false, "CCUAAACCCAA-TACGGTTGGGT-G", 25); |
|---|
| 930 | |
|---|
| 931 | pos->stop_uncertain[2] = 'x'; |
|---|
| 932 | TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid uncertainty 'x'"); |
|---|
| 933 | |
|---|
| 934 | pos->stop_uncertain[2] = '+'; |
|---|
| 935 | TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid uncertainty '+'"); // invalid for stop |
|---|
| 936 | |
|---|
| 937 | pos->start_uncertain[2] = '+'; |
|---|
| 938 | pos->stop_uncertain[2] = '-'; |
|---|
| 939 | TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid positions 25^25 for uncertainties +-"); |
|---|
| 940 | |
|---|
| 941 | pos->stop_pos[2] = 26; |
|---|
| 942 | TEST_WRITE_GEN_POSITION_ERROR(pos, (void*)NULL); |
|---|
| 943 | |
|---|
| 944 | pos->stop_pos[0] = 100; |
|---|
| 945 | TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal stop position 100 (>length(=32))"); |
|---|
| 946 | } |
|---|
| 947 | |
|---|
| 948 | GB_close(gb_main); |
|---|
| 949 | } |
|---|
| 950 | |
|---|
| 951 | #endif // UNIT_TESTS |
|---|
| 952 | |
|---|