Opened 12 years ago

Closed 12 years ago

Last modified 5 years ago

#563 closed defect (fixed)

codon hash overflow in translator/realigner

Reported by: westram Owned by: westram
Priority: major Milestone: arb7.0
Component: Library (other) Version: SVN
Keywords: Cc:

Description

Reproduce:

  • run
    arb_edit4 ../UNIT_TESTER/run/TEST_realign.arb
    
  • enable protein viewer
  • translate forward strand with start position 1

Effect:

  • fails assertion in DEBUG
  • might corrupt memory or perform invalid translation in NDEBUG

blocks #419

TODO

  • write test provoking assertion failure

Change History (4)

comment:1 Changed 12 years ago by westram

backtrace:

(gdb) whe
#0  AWT_translator (this=0xcacfd0, arb_protein_code_nr=14, __in_chrg=<value optimized out>, __vtt_parm=<value optimized out>) at AP_pro_a_nucs.cxx:229
#1  0x000000000053e3b8 in AWT_get_translator (code_nr=14) at AP_pro_a_nucs.cxx:407
#2  0x00000000005ee847 in AWT_pro_a_nucs_convert (arb_code_nr=14, data=0xb8e6c0 "ATGGCTAAAGAGAAATTTGAACGTACCAAACCGCACGTAAACATTGGTACAATCGGTCACGTTGACCACGGTAAAACCACTTTGACTGCTGCTATCACTACTGTGTTG", '-' <repeats 11 times>, ".......", size=126, pos=0, translate_all=false, create_start_codon=true, append_stop_codon=false, translatedSize=0x0) at Translate.cxx:147
#3  0x00000000004aec99 in TranslateGeneToAminoAcidSequence (seqTerm=0xc436e0, speciesName=0xbe6080 "BctFra12", startPos4Translation=0, translationMode=1) at ED4_ProteinViewer.cxx:573
#4  0x00000000004af87e in PV_AddNewAAseqTerminals (seqTerminal=0xbe5f40, speciesManager=0xbe5540) at ED4_ProteinViewer.cxx:774
#5  0x00000000004afc69 in PV_CreateAllTerminals (root=0x92a6f0) at ED4_ProteinViewer.cxx:853
#6  0x00000000004afd2d in PV_CallBackFunction (root=0x92a6f0) at ED4_ProteinViewer.cxx:872
#7  0x00007ffff6ea3644 in StrictlyTypedCallback<void, AW_root*, long, long>::operator() (this=0xc40898, p1=0x92a6f0, p2=0, p3=0) at /home/ralf/ARB-bilbo/ARB.alilink.fix/INCLUDE/cbtypes.h:117
[rest skipped]

comment:2 in reply to: ↑ description Changed 12 years ago by westram

  • Resolution set to fixed
  • Status changed from new to closed

by [12432]

  • might corrupt memory or perform invalid translation in NDEBUG

wrong: nothing corrupted

comment:3 Changed 11 years ago by westram

  • Milestone set to arb6.1

mark changes that got fixed after arb 6.0.x

comment:4 Changed 5 years ago by westram

  • Milestone changed from arb6.1 to arb7.0

Milestone renamed

Note: See TracTickets for help on using tickets.